Incidental Mutation 'R4552:Papolb'
ID334004
Institutional Source Beutler Lab
Gene Symbol Papolb
Ensembl Gene ENSMUSG00000074817
Gene Namepoly (A) polymerase beta (testis specific)
SynonymsPapt, TPAP, Plap-ps, Papola-ps
MMRRC Submission 041783-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4552 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location142525838-142530076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142529178 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 237 (I237V)
Ref Sequence ENSEMBL: ENSMUSP00000100595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063635] [ENSMUST00000085758] [ENSMUST00000099400] [ENSMUST00000110785]
Predicted Effect probably benign
Transcript: ENSMUST00000063635
SMART Domains Protein: ENSMUSP00000064539
Gene: ENSMUSG00000029576

DomainStartEndE-ValueType
RA 61 164 1.68e-15 SMART
Blast:FHA 265 332 2e-25 BLAST
low complexity region 344 354 N/A INTRINSIC
low complexity region 550 560 N/A INTRINSIC
DIL 634 743 6.19e-34 SMART
low complexity region 950 964 N/A INTRINSIC
PDZ 979 1056 3.86e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085758
SMART Domains Protein: ENSMUSP00000082910
Gene: ENSMUSG00000029576

DomainStartEndE-ValueType
RA 90 193 1.68e-15 SMART
Blast:FHA 294 361 2e-25 BLAST
low complexity region 373 383 N/A INTRINSIC
low complexity region 579 589 N/A INTRINSIC
DIL 663 772 6.19e-34 SMART
low complexity region 979 993 N/A INTRINSIC
PDZ 1008 1085 3.86e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099400
AA Change: I237V

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100595
Gene: ENSMUSG00000074817
AA Change: I237V

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:PAP_central 22 365 1.2e-118 PFAM
Pfam:NTP_transf_2 77 176 7.9e-16 PFAM
Pfam:PAP_RNA-bind 367 436 2.3e-22 PFAM
low complexity region 593 610 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110785
SMART Domains Protein: ENSMUSP00000106412
Gene: ENSMUSG00000029576

DomainStartEndE-ValueType
RA 61 164 1.68e-15 SMART
Blast:FHA 265 332 2e-25 BLAST
low complexity region 344 354 N/A INTRINSIC
low complexity region 550 560 N/A INTRINSIC
DIL 634 743 6.19e-34 SMART
low complexity region 973 987 N/A INTRINSIC
PDZ 1002 1079 3.86e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139824
Meta Mutation Damage Score 0.0866 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 97% (62/64)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility associated with reduced testes weight, smaller seminiferous tubules, and arrested spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Arhgap33 A T 7: 30,519,108 probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Camta1 T C 4: 151,792,502 R79G probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cep128 T C 12: 91,294,162 E309G probably damaging Het
Chit1 A G 1: 134,144,051 T100A probably benign Het
Dalrd3 A G 9: 108,572,230 D454G possibly damaging Het
Ddx19a G A 8: 110,978,566 Q308* probably null Het
Dmxl2 T C 9: 54,451,763 N395S probably damaging Het
Dnah17 T C 11: 118,052,943 D3125G possibly damaging Het
Dnah5 T C 15: 28,397,154 V3331A probably benign Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dner T C 1: 84,383,857 Y677C probably damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Hid1 G A 11: 115,358,679 T240M possibly damaging Het
Igbp1b T A 6: 138,658,114 M111L probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Klk4 C A 7: 43,884,019 H101N probably benign Het
Mrgpra2b C A 7: 47,464,006 S300I probably benign Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Nbas T C 12: 13,335,937 probably null Het
Nif3l1 C T 1: 58,449,324 probably benign Het
Noct T A 3: 51,250,168 I309N probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf2l A T 3: 145,151,083 T600S probably benign Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr1391 A T 11: 49,327,950 M180L probably benign Het
Olfr24 A G 9: 18,755,134 V167A possibly damaging Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr815 T C 10: 129,902,123 M196V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pclo T C 5: 14,669,271 S1141P unknown Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Ppargc1a C T 5: 51,463,215 probably benign Het
Ptchd4 A T 17: 42,502,455 I416L probably benign Het
Rhpn1 G A 15: 75,714,119 R627H probably benign Het
Ric8a G A 7: 140,861,337 G182S probably damaging Het
Rims1 T C 1: 22,373,494 D895G probably damaging Het
Rrp1b G A 17: 32,056,010 probably benign Het
Rtf1 T A 2: 119,730,729 D636E probably benign Het
Scn3a T C 2: 65,524,179 D333G probably benign Het
Sema6a A G 18: 47,291,923 L207P probably damaging Het
Shcbp1 A T 8: 4,749,779 Y160* probably null Het
Slc27a1 A T 8: 71,580,066 probably null Het
Ston2 C T 12: 91,641,872 R818Q probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tjap1 A T 17: 46,260,027 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Vmn1r57 A G 7: 5,220,668 D64G possibly damaging Het
Vmn2r73 T A 7: 85,875,847 D31V probably benign Het
Vmn2r-ps41 A T 7: 9,177,064 noncoding transcript Het
Other mutations in Papolb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02445:Papolb APN 5 142528725 missense probably benign 0.01
R0393:Papolb UTSW 5 142529456 missense probably damaging 0.98
R4551:Papolb UTSW 5 142529178 missense probably benign 0.30
R4553:Papolb UTSW 5 142529178 missense probably benign 0.30
R5121:Papolb UTSW 5 142528837 missense probably benign 0.00
R5261:Papolb UTSW 5 142529654 missense possibly damaging 0.85
R5348:Papolb UTSW 5 142529217 missense possibly damaging 0.66
R5861:Papolb UTSW 5 142529237 missense possibly damaging 0.59
R6454:Papolb UTSW 5 142529598 missense possibly damaging 0.77
R6860:Papolb UTSW 5 142528896 missense possibly damaging 0.52
R6902:Papolb UTSW 5 142528151 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGGTACCTGTCACTAGGATTC -3'
(R):5'- TCCAGAAGATTTGGACCTACGAG -3'

Sequencing Primer
(F):5'- TCTTGGGTCCCATACAGGCAAG -3'
(R):5'- TGGACCTACGAGATGATAGTCTGC -3'
Posted On2015-08-18