Incidental Mutation 'R4552:Ric8a'
ID334014
Institutional Source Beutler Lab
Gene Symbol Ric8a
Ensembl Gene ENSMUSG00000025485
Gene NameRIC8 guanine nucleotide exchange factor A
Synonymssynembryn, RIC-8, Ric8
MMRRC Submission 041783-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4552 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140856957-140864372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140861337 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 182 (G182S)
Ref Sequence ENSEMBL: ENSMUSP00000147952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026557] [ENSMUST00000026558] [ENSMUST00000026559] [ENSMUST00000106048] [ENSMUST00000137024] [ENSMUST00000209766] [ENSMUST00000210708] [ENSMUST00000211624] [ENSMUST00000211179] [ENSMUST00000210296] [ENSMUST00000210710]
Predicted Effect probably benign
Transcript: ENSMUST00000026557
SMART Domains Protein: ENSMUSP00000026557
Gene: ENSMUSG00000025484

DomainStartEndE-ValueType
Pfam:SNARE 20 82 3.4e-13 PFAM
transmembrane domain 87 106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000026558
AA Change: G417S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026558
Gene: ENSMUSG00000025485
AA Change: G417S

DomainStartEndE-ValueType
Pfam:Ric8 66 505 2.3e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026559
SMART Domains Protein: ENSMUSP00000026559
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 184 5.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106048
SMART Domains Protein: ENSMUSP00000101663
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 184 8.7e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131850
Predicted Effect probably benign
Transcript: ENSMUST00000137024
SMART Domains Protein: ENSMUSP00000114247
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 178 1.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153498
Predicted Effect probably damaging
Transcript: ENSMUST00000209766
AA Change: G182S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210708
Predicted Effect probably benign
Transcript: ENSMUST00000211624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210601
Predicted Effect probably benign
Transcript: ENSMUST00000211179
Predicted Effect probably benign
Transcript: ENSMUST00000210296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209318
Predicted Effect probably benign
Transcript: ENSMUST00000210710
Meta Mutation Damage Score 0.9074 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 97% (62/64)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in lethality during gastrulation. Heterozygotes exhibit impaired spatial learning and increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Arhgap33 A T 7: 30,519,108 probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Camta1 T C 4: 151,792,502 R79G probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cep128 T C 12: 91,294,162 E309G probably damaging Het
Chit1 A G 1: 134,144,051 T100A probably benign Het
Dalrd3 A G 9: 108,572,230 D454G possibly damaging Het
Ddx19a G A 8: 110,978,566 Q308* probably null Het
Dmxl2 T C 9: 54,451,763 N395S probably damaging Het
Dnah17 T C 11: 118,052,943 D3125G possibly damaging Het
Dnah5 T C 15: 28,397,154 V3331A probably benign Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dner T C 1: 84,383,857 Y677C probably damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Hid1 G A 11: 115,358,679 T240M possibly damaging Het
Igbp1b T A 6: 138,658,114 M111L probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Klk4 C A 7: 43,884,019 H101N probably benign Het
Mrgpra2b C A 7: 47,464,006 S300I probably benign Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Nbas T C 12: 13,335,937 probably null Het
Nif3l1 C T 1: 58,449,324 probably benign Het
Noct T A 3: 51,250,168 I309N probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf2l A T 3: 145,151,083 T600S probably benign Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr1391 A T 11: 49,327,950 M180L probably benign Het
Olfr24 A G 9: 18,755,134 V167A possibly damaging Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr815 T C 10: 129,902,123 M196V probably benign Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pclo T C 5: 14,669,271 S1141P unknown Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Ppargc1a C T 5: 51,463,215 probably benign Het
Ptchd4 A T 17: 42,502,455 I416L probably benign Het
Rhpn1 G A 15: 75,714,119 R627H probably benign Het
Rims1 T C 1: 22,373,494 D895G probably damaging Het
Rrp1b G A 17: 32,056,010 probably benign Het
Rtf1 T A 2: 119,730,729 D636E probably benign Het
Scn3a T C 2: 65,524,179 D333G probably benign Het
Sema6a A G 18: 47,291,923 L207P probably damaging Het
Shcbp1 A T 8: 4,749,779 Y160* probably null Het
Slc27a1 A T 8: 71,580,066 probably null Het
Ston2 C T 12: 91,641,872 R818Q probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tjap1 A T 17: 46,260,027 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Vmn1r57 A G 7: 5,220,668 D64G possibly damaging Het
Vmn2r73 T A 7: 85,875,847 D31V probably benign Het
Vmn2r-ps41 A T 7: 9,177,064 noncoding transcript Het
Other mutations in Ric8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Ric8a APN 7 140862357 missense probably benign 0.00
R0277:Ric8a UTSW 7 140857900 unclassified probably benign
R0529:Ric8a UTSW 7 140860893 missense probably damaging 1.00
R0707:Ric8a UTSW 7 140857973 unclassified probably benign
R1272:Ric8a UTSW 7 140862376 missense probably benign 0.22
R1627:Ric8a UTSW 7 140858178 missense probably damaging 0.98
R1655:Ric8a UTSW 7 140860895 missense probably benign 0.01
R2281:Ric8a UTSW 7 140861938 missense probably benign 0.44
R2327:Ric8a UTSW 7 140859558 missense probably damaging 1.00
R3721:Ric8a UTSW 7 140861961 critical splice donor site probably null
R4287:Ric8a UTSW 7 140861422 missense probably damaging 1.00
R4504:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4505:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4506:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4507:Ric8a UTSW 7 140858516 missense probably benign 0.03
R5500:Ric8a UTSW 7 140858315 missense probably benign 0.43
R6737:Ric8a UTSW 7 140858876 splice site probably null
R8150:Ric8a UTSW 7 140861356 missense probably damaging 1.00
R8391:Ric8a UTSW 7 140858003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACAAGCTTGTCCGCCTC -3'
(R):5'- TCCTATGTACTACTGGTTCGAGC -3'

Sequencing Primer
(F):5'- AAGCTTGTCCGCCTCATGAC -3'
(R):5'- ACTACTGGTTCGAGCTGGAGAG -3'
Posted On2015-08-18