Incidental Mutation 'R0225:Gadd45b'
ID 33866
Institutional Source Beutler Lab
Gene Symbol Gadd45b
Ensembl Gene ENSMUSG00000015312
Gene Name growth arrest and DNA-damage-inducible 45 beta
Synonyms Myd118
MMRRC Submission 038470-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.774) question?
Stock # R0225 (G1)
Quality Score 116
Status Validated
Chromosome 10
Chromosomal Location 80765925-80768038 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80766181 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 11 (N11S)
Ref Sequence ENSEMBL: ENSMUSP00000015456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015456] [ENSMUST00000220246]
AlphaFold P22339
Predicted Effect probably benign
Transcript: ENSMUST00000015456
AA Change: N11S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000015456
Gene: ENSMUSG00000015312
AA Change: N11S

DomainStartEndE-ValueType
Pfam:Ribosomal_L7Ae 21 121 1.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219449
Predicted Effect probably benign
Transcript: ENSMUST00000220246
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The genes in this group respond to environmental stresses by mediating activation of the p38/JNK pathway. This activation is mediated via their proteins binding and activating MTK1/MEKK4 kinase, which is an upstream activator of both p38 and JNK MAPKs. The function of these genes or their protein products is involved in the regulation of growth and apoptosis. These genes are regulated by different mechanisms, but they are often coordinately expressed and can function cooperatively in inhibiting cell growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus affects immune response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,139,378 (GRCm39) L1470Q probably damaging Het
Abraxas2 G A 7: 132,476,584 (GRCm39) R105Q probably damaging Het
Arhgap23 G T 11: 97,335,154 (GRCm39) V70L probably benign Het
Bicd1 T C 6: 149,414,448 (GRCm39) I387T probably benign Het
Cd59b G A 2: 103,909,286 (GRCm39) probably null Het
Chn2 T C 6: 54,267,436 (GRCm39) probably benign Het
Col18a1 T C 10: 76,924,748 (GRCm39) S14G possibly damaging Het
Col5a2 A G 1: 45,446,195 (GRCm39) I461T probably benign Het
Dele1 G A 18: 38,394,317 (GRCm39) V505I probably benign Het
Dnlz T C 2: 26,241,380 (GRCm39) N116S probably damaging Het
Esyt2 A G 12: 116,331,330 (GRCm39) N736S probably damaging Het
F11 T C 8: 45,702,114 (GRCm39) T267A probably benign Het
Fam234b T G 6: 135,194,072 (GRCm39) S242A possibly damaging Het
Garnl3 T C 2: 32,896,816 (GRCm39) T608A possibly damaging Het
Gata3 T C 2: 9,879,620 (GRCm39) T119A probably benign Het
Gm10647 A G 9: 66,705,777 (GRCm39) probably benign Het
Gm10936 G A 10: 117,084,035 (GRCm39) noncoding transcript Het
Gzmd A G 14: 56,367,161 (GRCm39) W244R probably damaging Het
Hdac2 T A 10: 36,865,180 (GRCm39) D131E probably benign Het
Hira T A 16: 18,774,921 (GRCm39) F949I probably benign Het
Ighv15-2 T G 12: 114,528,657 (GRCm39) probably benign Het
Il3 A G 11: 54,156,506 (GRCm39) probably null Het
Itgae A C 11: 73,002,168 (GRCm39) M91L probably benign Het
Jkampl A G 6: 73,446,402 (GRCm39) L49P possibly damaging Het
Kat2b A G 17: 53,948,238 (GRCm39) E336G probably damaging Het
Kctd21 T A 7: 96,997,298 (GRCm39) I257N probably benign Het
Kif23 C G 9: 61,832,976 (GRCm39) probably benign Het
Lgi3 A T 14: 70,770,261 (GRCm39) I109L probably benign Het
Lhx9 A T 1: 138,766,417 (GRCm39) C124S probably damaging Het
Lipo4 A G 19: 33,479,006 (GRCm39) V278A probably benign Het
Lrch3 T A 16: 32,782,124 (GRCm39) probably benign Het
Lrp1b T C 2: 40,486,995 (GRCm39) E142G probably damaging Het
Map9 G A 3: 82,267,290 (GRCm39) probably benign Het
Miox C T 15: 89,218,657 (GRCm39) probably benign Het
Mndal A T 1: 173,685,079 (GRCm39) probably benign Het
Mug2 G T 6: 122,051,673 (GRCm39) V952L possibly damaging Het
Nepn A T 10: 52,276,533 (GRCm39) T29S probably damaging Het
Or14a260 A G 7: 85,984,803 (GRCm39) I267T probably benign Het
Or4k5 T G 14: 50,386,092 (GRCm39) K80Q probably damaging Het
Or8d1b A G 9: 38,887,574 (GRCm39) I201V probably benign Het
Or8k53 T C 2: 86,178,072 (GRCm39) I13V possibly damaging Het
Phf3 A T 1: 30,844,146 (GRCm39) D1604E probably benign Het
Plekhn1 T C 4: 156,312,700 (GRCm39) R53G probably benign Het
Prickle1 A G 15: 93,408,658 (GRCm39) L47P possibly damaging Het
Ptar1 T A 19: 23,695,459 (GRCm39) C309S probably benign Het
Rapgef2 A T 3: 79,011,412 (GRCm39) S224R probably damaging Het
Rimoc1 T C 15: 4,015,776 (GRCm39) K263E probably damaging Het
Siglecg G A 7: 43,060,595 (GRCm39) G325D probably damaging Het
Skor2 A T 18: 76,946,793 (GRCm39) I172F unknown Het
Slc9a1 A G 4: 133,147,916 (GRCm39) K645E probably benign Het
St14 T A 9: 31,019,580 (GRCm39) probably null Het
Tas2r120 T A 6: 132,634,552 (GRCm39) Y211* probably null Het
Tbxa2r C A 10: 81,168,734 (GRCm39) T141K possibly damaging Het
Tpd52l1 A G 10: 31,255,252 (GRCm39) S32P probably damaging Het
Ttn T A 2: 76,540,468 (GRCm39) R34173W probably damaging Het
Ttn C A 2: 76,623,474 (GRCm39) V15368L possibly damaging Het
Tyms A G 5: 30,268,256 (GRCm39) I148T probably damaging Het
Vmn1r45 A T 6: 89,910,492 (GRCm39) Y159* probably null Het
Vmn1r58 A C 7: 5,413,865 (GRCm39) S122A probably benign Het
Vmn2r13 C A 5: 109,322,915 (GRCm39) V125L probably benign Het
Vmn2r92 C T 17: 18,388,219 (GRCm39) A408V probably damaging Het
Vps13b T C 15: 35,887,407 (GRCm39) I3272T probably benign Het
Wfdc8 A G 2: 164,439,105 (GRCm39) Y426H probably benign Het
Zfp948 A T 17: 21,807,556 (GRCm39) K249N probably damaging Het
Zfyve1 A G 12: 83,601,847 (GRCm39) probably benign Het
Zyg11a G A 4: 108,061,838 (GRCm39) T321I probably damaging Het
Other mutations in Gadd45b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Gadd45b APN 10 80,767,075 (GRCm39) missense probably damaging 1.00
IGL02249:Gadd45b APN 10 80,766,967 (GRCm39) missense possibly damaging 0.84
BB009:Gadd45b UTSW 10 80,766,169 (GRCm39) missense possibly damaging 0.76
BB019:Gadd45b UTSW 10 80,766,169 (GRCm39) missense possibly damaging 0.76
R7127:Gadd45b UTSW 10 80,766,999 (GRCm39) missense probably benign 0.00
R7932:Gadd45b UTSW 10 80,766,169 (GRCm39) missense possibly damaging 0.76
R8009:Gadd45b UTSW 10 80,766,984 (GRCm39) missense probably benign 0.02
R9375:Gadd45b UTSW 10 80,766,284 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GGGAAGTCATATAAACCGCTCGCAG -3'
(R):5'- ATTCATCAGTTTGGCCGCCTCG -3'

Sequencing Primer
(F):5'- AACCCTGGGTCTGCGTTC -3'
(R):5'- TTGGCCGCCTCGTACAC -3'
Posted On 2013-05-09