Mutagenetix > Incidental Mutation

Incidental Mutation 'R0225:St14'

33858

Institutional Source

Beutler Lab

Gene Symbol

St14

Ensembl Gene

ENSMUSG00000031995

Gene Name

suppression of tumorigenicity 14 (colon carcinoma)

Synonyms

MT-SP1, matriptase, Tmprss14, Prss14, Epithin

MMRRC Submission

038470-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0225 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31089402-31131853 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 31108284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034478 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034478] [ENSMUST00000034478] [ENSMUST00000123557] [ENSMUST00000123557] [ENSMUST00000214418]

AlphaFold

P56677

Predicted Effect

probably null
Transcript: ENSMUST00000034478

SMART Domains

Protein: ENSMUSP00000034478
Gene: ENSMUSG00000031995

Domain	Start	End	E-Value	Type
transmembrane domain	55	77	N/A	INTRINSIC
Pfam:SEA	88	181	7.9e-17	PFAM
CUB	214	334	4.24e-14	SMART
CUB	340	447	4.37e-25	SMART
LDLa	452	486	2.31e-9	SMART
LDLa	487	523	4.08e-10	SMART
LDLa	524	561	3.98e-13	SMART
LDLa	566	604	1.48e-7	SMART
Tryp_SPc	614	849	1.25e-93	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000034478

SMART Domains

Protein: ENSMUSP00000034478
Gene: ENSMUSG00000031995

Domain	Start	End	E-Value	Type
transmembrane domain	55	77	N/A	INTRINSIC
Pfam:SEA	88	181	7.9e-17	PFAM
CUB	214	334	4.24e-14	SMART
CUB	340	447	4.37e-25	SMART
LDLa	452	486	2.31e-9	SMART
LDLa	487	523	4.08e-10	SMART
LDLa	524	561	3.98e-13	SMART
LDLa	566	604	1.48e-7	SMART
Tryp_SPc	614	849	1.25e-93	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123557

Predicted Effect

probably benign
Transcript: ENSMUST00000123557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148789

Predicted Effect

probably benign
Transcript: ENSMUST00000214418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217404

Meta Mutation Damage Score

0.9497

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus results in pleiotropic defects affecting the development of the epidermis, hair follicles, and immune system. Mutant mice become dehydrated due to impaired epidermal barrier function and die within days of birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	G	A	18: 38,261,264	V505I	probably benign	Het
4931417E11Rik	A	G	6: 73,469,419	L49P	possibly damaging	Het
Abca16	T	A	7: 120,540,155	L1470Q	probably damaging	Het
Abraxas2	G	A	7: 132,874,855	R105Q	probably damaging	Het
Arhgap23	G	T	11: 97,444,328	V70L	probably benign	Het
AW549877	T	C	15: 3,986,294	K263E	probably damaging	Het
Bicd1	T	C	6: 149,512,950	I387T	probably benign	Het
Cd59b	G	A	2: 104,078,941		probably null	Het
Chn2	T	C	6: 54,290,451		probably benign	Het
Col18a1	T	C	10: 77,088,914	S14G	possibly damaging	Het
Col5a2	A	G	1: 45,407,035	I461T	probably benign	Het
Dnlz	T	C	2: 26,351,368	N116S	probably damaging	Het
Esyt2	A	G	12: 116,367,710	N736S	probably damaging	Het
F11	T	C	8: 45,249,077	T267A	probably benign	Het
Fam234b	T	G	6: 135,217,074	S242A	possibly damaging	Het
Gadd45b	A	G	10: 80,930,347	N11S	probably benign	Het
Garnl3	T	C	2: 33,006,804	T608A	possibly damaging	Het
Gata3	T	C	2: 9,874,809	T119A	probably benign	Het
Gm10647	A	G	9: 66,798,495		probably benign	Het
Gm10936	G	A	10: 117,248,130		noncoding transcript	Het
Gzmd	A	G	14: 56,129,704	W244R	probably damaging	Het
Hdac2	T	A	10: 36,989,184	D131E	probably benign	Het
Hira	T	A	16: 18,956,171	F949I	probably benign	Het
Ighv15-2	T	G	12: 114,565,037		probably benign	Het
Il3	A	G	11: 54,265,680		probably null	Het
Itgae	A	C	11: 73,111,342	M91L	probably benign	Het
Kat2b	A	G	17: 53,641,210	E336G	probably damaging	Het
Kctd21	T	A	7: 97,348,091	I257N	probably benign	Het
Kif23	C	G	9: 61,925,694		probably benign	Het
Lgi3	A	T	14: 70,532,821	I109L	probably benign	Het
Lhx9	A	T	1: 138,838,679	C124S	probably damaging	Het
Lipo4	A	G	19: 33,501,606	V278A	probably benign	Het
Lrch3	T	A	16: 32,961,754		probably benign	Het
Lrp1b	T	C	2: 40,596,983	E142G	probably damaging	Het
Map9	G	A	3: 82,359,983		probably benign	Het
Miox	C	T	15: 89,334,454		probably benign	Het
Mndal	A	T	1: 173,857,513		probably benign	Het
Mug2	G	T	6: 122,074,714	V952L	possibly damaging	Het
Nepn	A	T	10: 52,400,437	T29S	probably damaging	Het
Olfr1055	T	C	2: 86,347,728	I13V	possibly damaging	Het
Olfr307	A	G	7: 86,335,595	I267T	probably benign	Het
Olfr729	T	G	14: 50,148,635	K80Q	probably damaging	Het
Olfr933	A	G	9: 38,976,278	I201V	probably benign	Het
Phf3	A	T	1: 30,805,065	D1604E	probably benign	Het
Plekhn1	T	C	4: 156,228,243	R53G	probably benign	Het
Prickle1	A	G	15: 93,510,777	L47P	possibly damaging	Het
Ptar1	T	A	19: 23,718,095	C309S	probably benign	Het
Rapgef2	A	T	3: 79,104,105	S224R	probably damaging	Het
Siglecg	G	A	7: 43,411,171	G325D	probably damaging	Het
Skor2	A	T	18: 76,859,098	I172F	unknown	Het
Slc9a1	A	G	4: 133,420,605	K645E	probably benign	Het
Tas2r120	T	A	6: 132,657,589	Y211*	probably null	Het
Tbxa2r	C	A	10: 81,332,900	T141K	possibly damaging	Het
Tpd52l1	A	G	10: 31,379,256	S32P	probably damaging	Het
Ttn	T	A	2: 76,710,124	R34173W	probably damaging	Het
Ttn	C	A	2: 76,793,130	V15368L	possibly damaging	Het
Tyms	A	G	5: 30,063,258	I148T	probably damaging	Het
Vmn1r45	A	T	6: 89,933,510	Y159*	probably null	Het
Vmn1r58	A	C	7: 5,410,866	S122A	probably benign	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Vps13b	T	C	15: 35,887,261	I3272T	probably benign	Het
Wfdc8	A	G	2: 164,597,185	Y426H	probably benign	Het
Zfp948	A	T	17: 21,587,294	K249N	probably damaging	Het
Zfyve1	A	G	12: 83,555,073		probably benign	Het
Zyg11a	G	A	4: 108,204,641	T321I	probably damaging	Het

Other mutations in St14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00781:St14	APN	9	31103779	missense	probably damaging	1.00
IGL01443:St14	APN	9	31100193	nonsense	probably null
IGL01816:St14	APN	9	31108267	missense	possibly damaging	0.71
IGL02100:St14	APN	9	31100130	splice site	probably benign
IGL02494:St14	APN	9	31108645	missense	possibly damaging	0.47
IGL02588:St14	APN	9	31090033	splice site	probably benign
IGL02663:St14	APN	9	31100382	splice site	probably null
IGL02711:St14	APN	9	31089900	missense	probably benign	0.05
IGL03130:St14	APN	9	31097071	critical splice donor site	probably null
IGL03296:St14	APN	9	31108712	missense	probably damaging	0.98
IGL03400:St14	APN	9	31096971	splice site	probably benign
R0101:St14	UTSW	9	31097107	missense	probably benign	0.23
R0335:St14	UTSW	9	31091324	splice site	probably benign
R0892:St14	UTSW	9	31100428	missense	probably benign	0.38
R1334:St14	UTSW	9	31108210	missense	probably damaging	1.00
R1487:St14	UTSW	9	31097180	missense	probably damaging	1.00
R1521:St14	UTSW	9	31108215	missense	probably benign	0.03
R1782:St14	UTSW	9	31100164	missense	probably damaging	1.00
R1920:St14	UTSW	9	31089870	missense	possibly damaging	0.94
R1921:St14	UTSW	9	31089870	missense	possibly damaging	0.94
R1922:St14	UTSW	9	31089870	missense	possibly damaging	0.94
R1933:St14	UTSW	9	31106212	missense	probably benign	0.00
R2070:St14	UTSW	9	31091373	missense	probably damaging	1.00
R2411:St14	UTSW	9	31108234	missense	probably benign	0.13
R4152:St14	UTSW	9	31090506	missense	probably benign	0.08
R4375:St14	UTSW	9	31090458	missense	probably benign	0.02
R4419:St14	UTSW	9	31096928	missense	probably damaging	1.00
R4747:St14	UTSW	9	31103757	missense	possibly damaging	0.78
R4791:St14	UTSW	9	31095622	missense	probably benign	0.27
R4915:St14	UTSW	9	31108664	nonsense	probably null
R5056:St14	UTSW	9	31097551	splice site	probably null
R5134:St14	UTSW	9	31095583	missense	probably benign	0.00
R5241:St14	UTSW	9	31100418	nonsense	probably null
R5325:St14	UTSW	9	31096978	splice site	probably null
R5644:St14	UTSW	9	31106510	missense	probably benign
R5828:St14	UTSW	9	31091507	missense	probably damaging	1.00
R5922:St14	UTSW	9	31129904	intron	probably benign
R5930:St14	UTSW	9	31103760	missense	probably damaging	1.00
R5963:St14	UTSW	9	31106557	intron	probably benign
R6911:St14	UTSW	9	31106785	missense	probably benign	0.00
R6937:St14	UTSW	9	31129660	splice site	probably null
R6986:St14	UTSW	9	31096549	missense	probably damaging	0.98
R7226:St14	UTSW	9	31100152	missense	possibly damaging	0.63
R7395:St14	UTSW	9	31096899	missense	probably benign	0.29
R7400:St14	UTSW	9	31108275	missense	probably benign	0.36
R8194:St14	UTSW	9	31131625	start codon destroyed	probably null	0.95
R8886:St14	UTSW	9	31097124	missense	possibly damaging	0.93
R9248:St14	UTSW	9	31091609	missense	probably damaging	1.00
R9440:St14	UTSW	9	31096549	missense	probably damaging	0.98
Z1177:St14	UTSW	9	31090507	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCAGGCAGTCTAAGTCACTTGCAC -3'
(R):5'- TCTGAGCCATTTCAGGCCATGATG -3'

Sequencing Primer
(F):5'- GTCTAAGTCACTTGCACAAAGG -3'
(R):5'- CATTTCAGGCCATGATGGTGAG -3'

Posted On

2013-05-09