Incidental Mutation 'R0295:Rasa2'
ID37693
Institutional Source Beutler Lab
Gene Symbol Rasa2
Ensembl Gene ENSMUSG00000032413
Gene NameRAS p21 protein activator 2
SynonymsGAP1m, 5430433H21Rik
MMRRC Submission 038512-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R0295 (G1)
Quality Score219
Status Validated
Chromosome9
Chromosomal Location96539300-96631617 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 96545810 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034984] [ENSMUST00000128346]
Predicted Effect probably null
Transcript: ENSMUST00000034984
SMART Domains Protein: ENSMUSP00000034984
Gene: ENSMUSG00000032413

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
C2 38 136 3.78e-16 SMART
C2 171 287 8.48e-19 SMART
RasGAP 300 641 7.05e-140 SMART
PH 604 706 1.98e-17 SMART
BTK 706 742 1.39e-18 SMART
low complexity region 824 838 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122752
Predicted Effect probably benign
Transcript: ENSMUST00000128346
SMART Domains Protein: ENSMUSP00000115629
Gene: ENSMUSG00000032413

DomainStartEndE-ValueType
C2 3 79 6.86e-5 SMART
C2 114 230 8.48e-19 SMART
RasGAP 243 584 7.05e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188853
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,282,594 I173N probably damaging Het
2610028H24Rik G A 10: 76,454,808 S127N probably damaging Het
Abcc8 T C 7: 46,118,054 R953G probably benign Het
Adamtsl3 T A 7: 82,548,005 probably null Het
Adh4 A G 3: 138,429,076 D337G probably damaging Het
Apob T A 12: 8,002,181 Y1207* probably null Het
Birc6 T C 17: 74,613,362 probably benign Het
Bms1 A G 6: 118,389,337 I1065T probably benign Het
Cacna1i T A 15: 80,356,211 L378Q probably damaging Het
Ccdc127 C A 13: 74,356,870 P179H probably damaging Het
Ccdc18 A T 5: 108,173,789 K586N probably damaging Het
Cep290 A C 10: 100,537,821 E1321A probably damaging Het
Ctc1 A G 11: 69,030,588 K682E possibly damaging Het
Cux1 A C 5: 136,313,212 V442G probably benign Het
Dph2 A T 4: 117,890,930 V150E possibly damaging Het
Etv6 A G 6: 134,266,275 D331G probably benign Het
Fbxo42 A G 4: 141,200,497 D696G probably damaging Het
Fbxo8 G A 8: 56,590,074 D198N probably benign Het
Gria4 T C 9: 4,793,840 T73A possibly damaging Het
H2afj C G 6: 136,808,604 R89G probably damaging Het
Ifng G T 10: 118,441,249 S32I possibly damaging Het
Ildr1 A G 16: 36,709,477 probably null Het
Knl1 A C 2: 119,088,839 D1824A probably damaging Het
Lamp3 A T 16: 19,701,108 Y108* probably null Het
Lcp1 A G 14: 75,199,420 I69V probably null Het
Lrp6 A T 6: 134,457,693 V1349E probably benign Het
Lrrcc1 A T 3: 14,565,849 E1009D probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Med14 G C X: 12,685,748 R1223G probably damaging Het
Mesd C T 7: 83,897,865 Q179* probably null Het
Myh7 A G 14: 54,984,821 probably benign Het
Myo6 T C 9: 80,283,579 I804T probably damaging Het
Neb T C 2: 52,284,285 I1521V possibly damaging Het
Nosip T A 7: 45,076,916 I249N probably damaging Het
Nostrin A C 2: 69,179,416 E296A probably benign Het
Olfr1280 T A 2: 111,316,154 V225D probably damaging Het
Olfr136 A T 17: 38,335,291 I45F probably damaging Het
Olfr491 T G 7: 108,317,685 S264A probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Oprk1 T C 1: 5,598,850 L173S possibly damaging Het
Pdzd7 A G 19: 45,037,072 V328A probably benign Het
Podxl2 A T 6: 88,849,678 S215R probably benign Het
Prss36 T G 7: 127,935,855 T418P possibly damaging Het
Ralgps2 T A 1: 156,823,985 probably benign Het
Rgs1 A T 1: 144,245,486 I149N probably damaging Het
Rgs16 A G 1: 153,743,737 E163G probably damaging Het
Rnf121 A G 7: 102,035,346 F120S possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slfn8 A T 11: 83,003,343 Y823* probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
St6gal1 T A 16: 23,356,203 probably benign Het
Tet3 G A 6: 83,369,139 P1304S probably benign Het
Timm29 T C 9: 21,593,076 probably null Het
Tpcn1 T A 5: 120,539,060 I687F probably damaging Het
Trim46 A G 3: 89,245,113 probably benign Het
Ttc23 T A 7: 67,669,852 probably benign Het
Ttll6 G T 11: 96,154,714 V586L probably benign Het
Ttn A T 2: 76,758,611 probably benign Het
Uba3 A T 6: 97,191,583 H160Q possibly damaging Het
Usp32 A G 11: 85,053,692 S316P probably damaging Het
Vcan T C 13: 89,712,191 I352M probably benign Het
Zcwpw1 G T 5: 137,817,472 L412F probably damaging Het
Zfp292 A T 4: 34,806,281 N2254K probably damaging Het
Zscan4e A G 7: 11,307,616 S138P probably damaging Het
Other mutations in Rasa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Rasa2 APN 9 96544860 missense probably damaging 1.00
IGL00661:Rasa2 APN 9 96577553 splice site probably benign
IGL00825:Rasa2 APN 9 96570719 missense probably benign 0.37
IGL01645:Rasa2 APN 9 96582781 nonsense probably null
IGL02260:Rasa2 APN 9 96544319 missense probably benign 0.08
IGL02568:Rasa2 APN 9 96580510 missense probably damaging 1.00
IGL02963:Rasa2 APN 9 96570785 missense probably damaging 1.00
R0018:Rasa2 UTSW 9 96571963 missense probably damaging 1.00
R0018:Rasa2 UTSW 9 96571963 missense probably damaging 1.00
R0144:Rasa2 UTSW 9 96592019 missense probably damaging 0.99
R0238:Rasa2 UTSW 9 96568407 missense probably damaging 1.00
R0238:Rasa2 UTSW 9 96568407 missense probably damaging 1.00
R0332:Rasa2 UTSW 9 96606176 missense probably damaging 1.00
R0348:Rasa2 UTSW 9 96571959 missense probably damaging 1.00
R0931:Rasa2 UTSW 9 96552404 missense possibly damaging 0.88
R1067:Rasa2 UTSW 9 96552323 missense probably damaging 1.00
R1485:Rasa2 UTSW 9 96544348 missense probably benign 0.00
R1562:Rasa2 UTSW 9 96545750 missense possibly damaging 0.89
R1698:Rasa2 UTSW 9 96568375 missense possibly damaging 0.56
R1980:Rasa2 UTSW 9 96570768 missense probably damaging 0.99
R3055:Rasa2 UTSW 9 96611473 missense possibly damaging 0.77
R4175:Rasa2 UTSW 9 96560777 missense probably benign 0.01
R4258:Rasa2 UTSW 9 96557380 intron probably benign
R4432:Rasa2 UTSW 9 96542407 unclassified probably benign
R4636:Rasa2 UTSW 9 96544337 missense probably benign
R4773:Rasa2 UTSW 9 96544417 missense probably benign
R4990:Rasa2 UTSW 9 96591989 missense probably benign 0.24
R5177:Rasa2 UTSW 9 96544791 nonsense probably null
R5462:Rasa2 UTSW 9 96571918 missense probably damaging 1.00
R5737:Rasa2 UTSW 9 96570665 critical splice donor site probably null
R5775:Rasa2 UTSW 9 96577468 splice site probably null
R5866:Rasa2 UTSW 9 96545770 missense probably benign 0.00
R5938:Rasa2 UTSW 9 96611389 missense possibly damaging 0.50
R6076:Rasa2 UTSW 9 96545646 missense probably benign
R6216:Rasa2 UTSW 9 96544304 missense probably damaging 1.00
R6743:Rasa2 UTSW 9 96611440 missense probably damaging 1.00
R6982:Rasa2 UTSW 9 96560750 missense probably damaging 1.00
R7350:Rasa2 UTSW 9 96544355 missense probably benign 0.16
R7405:Rasa2 UTSW 9 96566027 missense probably benign 0.09
R7421:Rasa2 UTSW 9 96611447 missense unknown
R7490:Rasa2 UTSW 9 96566122 missense possibly damaging 0.48
R7515:Rasa2 UTSW 9 96552300 splice site probably null
R7547:Rasa2 UTSW 9 96611421 missense probably damaging 1.00
R7557:Rasa2 UTSW 9 96557425 missense probably damaging 0.98
R7894:Rasa2 UTSW 9 96602727 missense probably benign 0.13
R7977:Rasa2 UTSW 9 96602727 missense probably benign 0.13
RF017:Rasa2 UTSW 9 96631468 small insertion probably benign
RF029:Rasa2 UTSW 9 96631467 small insertion probably benign
RF047:Rasa2 UTSW 9 96631467 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGCCAGTTTCCGTTGAGATACG -3'
(R):5'- GTTCTTATGCAGACAGTGGCCTCC -3'

Sequencing Primer
(F):5'- TCCGTTGAGATACGCTGAG -3'
(R):5'- GCACTTGTATGGCATCTGC -3'
Posted On2013-05-23