Incidental Mutation 'R4750:Slc12a5'
ID357469
Institutional Source Beutler Lab
Gene Symbol Slc12a5
Ensembl Gene ENSMUSG00000017740
Gene Namesolute carrier family 12, member 5
SynonymsKCC2
MMRRC Submission 042031-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4750 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164960802-164999731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164982931 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 396 (M396V)
Ref Sequence ENSEMBL: ENSMUSP00000096690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099092] [ENSMUST00000202136] [ENSMUST00000202223] [ENSMUST00000202479] [ENSMUST00000202623]
Predicted Effect probably benign
Transcript: ENSMUST00000099092
AA Change: M396V

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000096690
Gene: ENSMUSG00000017740
AA Change: M396V

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 304 5.2e-22 PFAM
Pfam:AA_permease_2 364 632 1e-17 PFAM
Pfam:AA_permease 389 676 1.9e-42 PFAM
Pfam:SLC12 688 814 2.1e-19 PFAM
Pfam:SLC12 807 959 1.8e-20 PFAM
low complexity region 978 1002 N/A INTRINSIC
Pfam:SLC12 1009 1115 2.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135918
Predicted Effect probably benign
Transcript: ENSMUST00000202136
SMART Domains Protein: ENSMUSP00000143973
Gene: ENSMUSG00000017740

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 175 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202223
AA Change: M419V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000143870
Gene: ENSMUSG00000017740
AA Change: M419V

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 1e-19 PFAM
Pfam:AA_permease_2 386 655 4.5e-15 PFAM
Pfam:AA_permease 412 699 3.7e-40 PFAM
Pfam:SLC12 711 837 7.2e-17 PFAM
Pfam:SLC12 830 982 6.2e-18 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1030 1133 8.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202479
SMART Domains Protein: ENSMUSP00000144540
Gene: ENSMUSG00000017740

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 176 5.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202623
AA Change: M419V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000144623
Gene: ENSMUSG00000017740
AA Change: M419V

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 5.3e-22 PFAM
Pfam:AA_permease_2 386 655 1.2e-17 PFAM
Pfam:AA_permease 412 699 2e-42 PFAM
Pfam:SLC12 711 837 2.1e-19 PFAM
Pfam:SLC12 830 982 1.8e-20 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1032 1138 2.2e-15 PFAM
Meta Mutation Damage Score 0.0843 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within a few minutes of birth of respiratory failure resulting from a motor nerve defect. Mice homozygous for a hypomorphic allele display postnatal lethality and tonic-clonic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008P14Rik C T 2: 32,379,413 probably null Het
1700074P13Rik A G 6: 40,921,021 W243R probably damaging Het
2510039O18Rik T A 4: 147,941,488 L155Q probably damaging Het
Aadac T C 3: 60,035,817 F48L probably benign Het
Aadat T A 8: 60,526,600 N165K probably benign Het
Acan C A 7: 79,092,718 D557E probably damaging Het
Adamts4 T A 1: 171,251,066 V85D probably benign Het
Agt A G 8: 124,556,937 V481A probably benign Het
Angpt1 T C 15: 42,676,401 N21D probably benign Het
Ankrd52 A C 10: 128,378,089 D38A probably damaging Het
Ap1g2 G T 14: 55,104,365 Q247K probably damaging Het
Apaf1 T C 10: 91,060,188 R341G probably damaging Het
Arf2 T C 11: 103,979,759 probably null Het
Arhgef1 A G 7: 24,918,576 probably benign Het
Bbox1 T A 2: 110,265,521 Y366F possibly damaging Het
Bmp3 A G 5: 98,872,558 E280G possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh12 T A 15: 21,583,808 V578D possibly damaging Het
Cdk19 T C 10: 40,476,199 S282P probably damaging Het
Cfap46 A G 7: 139,679,323 probably null Het
Cfhr3 T A 1: 139,584,828 noncoding transcript Het
Ctrc T A 4: 141,841,523 Y123F probably benign Het
Enpp4 A G 17: 44,102,355 M96T probably damaging Het
Exosc10 T A 4: 148,562,394 S154T possibly damaging Het
Fbxo21 G A 5: 118,000,468 R486H probably benign Het
Foxj3 C A 4: 119,616,590 A204E probably damaging Het
Gas6 T G 8: 13,476,227 D237A probably benign Het
Gimap8 A G 6: 48,650,427 S112G probably benign Het
Gm4787 T C 12: 81,378,367 N339S possibly damaging Het
Gm6185 T C 1: 161,182,363 noncoding transcript Het
Gramd3 A G 18: 56,432,300 E9G probably benign Het
Hmgxb3 A T 18: 61,167,496 D169E probably benign Het
Isl2 T A 9: 55,544,312 V162D probably benign Het
Kcns3 T A 12: 11,091,654 D348V probably damaging Het
Kcp G A 6: 29,484,626 P1318S probably benign Het
Kif12 T A 4: 63,167,783 Q415L probably damaging Het
Lama3 T A 18: 12,504,359 H45Q probably benign Het
Lonp2 A T 8: 86,631,502 K117M probably benign Het
Loxl4 T A 19: 42,605,004 N243Y probably damaging Het
Lrif1 C A 3: 106,735,564 Q662K probably benign Het
Lrrc37a T A 11: 103,455,480 I3187L probably benign Het
Lsg1 A G 16: 30,565,449 I521T probably damaging Het
Mecom T G 3: 29,957,530 K865Q probably damaging Het
Myh10 T C 11: 68,785,314 I790T probably damaging Het
Nek7 C T 1: 138,498,673 S234N probably damaging Het
Nepro T C 16: 44,730,182 L179P probably damaging Het
Nexn A G 3: 152,237,722 C649R probably damaging Het
Nsmf T C 2: 25,055,026 S34P probably damaging Het
Olfr1140 C T 2: 87,746,508 T104I probably benign Het
Olfr1339 T A 4: 118,734,733 V68D possibly damaging Het
Olfr1350 A G 7: 6,570,851 I287V probably benign Het
Olfr1364 A G 13: 21,573,743 S238P possibly damaging Het
Olfr354 T A 2: 36,907,716 S257T probably benign Het
Olfr406 T A 11: 74,269,420 F10L probably benign Het
Olfr417 A G 1: 174,368,922 I2V probably benign Het
Olfr685 A T 7: 105,180,926 I144N probably damaging Het
Olfr702 A G 7: 106,824,307 F73S probably damaging Het
P2rx5 G T 11: 73,164,877 K53N probably damaging Het
Pcdhb20 C A 18: 37,506,131 A570E possibly damaging Het
Pip4k2c T C 10: 127,211,417 H32R unknown Het
Pkhd1 T A 1: 20,524,112 D1259V possibly damaging Het
Plekha7 A T 7: 116,137,311 V889E probably damaging Het
Polr2b A C 5: 77,332,039 E546D possibly damaging Het
Ppm1l A G 3: 69,549,328 T193A probably damaging Het
Ppp1r37 G T 7: 19,531,520 D710E probably benign Het
Prdm4 A G 10: 85,899,221 F679L probably damaging Het
Prkcd A G 14: 30,610,301 M1T probably null Het
Rcor3 A G 1: 192,130,449 Y77H probably damaging Het
Rdh5 T C 10: 128,918,366 E66G possibly damaging Het
Slco5a1 T G 1: 12,879,280 T629P probably damaging Het
Smarca5 A C 8: 80,733,707 N133K probably benign Het
Spag5 T C 11: 78,320,052 M927T probably benign Het
Spint4 A T 2: 164,700,146 D39V probably damaging Het
Syt6 T A 3: 103,630,917 *512R probably null Het
Tmem247 T C 17: 86,922,342 C204R probably damaging Het
Tmem72 A G 6: 116,695,434 Y149H probably damaging Het
Trpm6 T C 19: 18,876,064 V1816A probably damaging Het
Usp35 A G 7: 97,310,339 V1008A possibly damaging Het
Washc4 T C 10: 83,591,052 S1075P probably damaging Het
Wdr34 T C 2: 30,033,920 T198A probably benign Het
Xylb G T 9: 119,359,313 G62* probably null Het
Zfp142 T C 1: 74,572,458 E623G probably damaging Het
Zfp239 A G 6: 117,871,739 Y146C probably damaging Het
Other mutations in Slc12a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Slc12a5 APN 2 164997121 missense probably damaging 1.00
IGL00425:Slc12a5 APN 2 164983281 missense probably damaging 1.00
IGL00976:Slc12a5 APN 2 164979304 missense probably damaging 1.00
IGL01654:Slc12a5 APN 2 164973755 missense possibly damaging 0.91
IGL01905:Slc12a5 APN 2 164990381 missense probably benign 0.02
IGL02205:Slc12a5 APN 2 164996479 missense probably benign 0.03
IGL02510:Slc12a5 APN 2 164982808 splice site probably benign
IGL02746:Slc12a5 APN 2 164974916 missense probably benign 0.01
R0051:Slc12a5 UTSW 2 164986663 missense probably damaging 1.00
R0254:Slc12a5 UTSW 2 164997245 critical splice donor site probably null
R0412:Slc12a5 UTSW 2 164994062 missense probably benign 0.05
R0587:Slc12a5 UTSW 2 164976533 missense probably damaging 1.00
R0835:Slc12a5 UTSW 2 164994038 missense probably damaging 0.97
R0932:Slc12a5 UTSW 2 164996885 splice site probably benign
R1643:Slc12a5 UTSW 2 164994027 missense probably benign 0.01
R1700:Slc12a5 UTSW 2 164992376 missense possibly damaging 0.94
R1760:Slc12a5 UTSW 2 164996128 missense probably damaging 0.99
R2063:Slc12a5 UTSW 2 164997147 missense probably damaging 1.00
R2293:Slc12a5 UTSW 2 164992330 missense probably benign 0.03
R2412:Slc12a5 UTSW 2 164976462 critical splice donor site probably null
R3035:Slc12a5 UTSW 2 164980258 missense probably benign 0.06
R3116:Slc12a5 UTSW 2 164996181 intron probably null
R3412:Slc12a5 UTSW 2 164968431 missense probably benign 0.26
R3788:Slc12a5 UTSW 2 164993775 missense probably damaging 1.00
R4039:Slc12a5 UTSW 2 164992330 missense probably benign 0.03
R4174:Slc12a5 UTSW 2 164979490 missense probably damaging 1.00
R4492:Slc12a5 UTSW 2 164979343 missense probably benign 0.08
R4608:Slc12a5 UTSW 2 164973765 missense probably damaging 0.99
R4994:Slc12a5 UTSW 2 164983365 intron probably null
R5103:Slc12a5 UTSW 2 164992433 missense probably damaging 1.00
R5539:Slc12a5 UTSW 2 164987206 missense possibly damaging 0.94
R5632:Slc12a5 UTSW 2 164987221 missense possibly damaging 0.86
R5771:Slc12a5 UTSW 2 164973768 missense possibly damaging 0.88
R6139:Slc12a5 UTSW 2 164992311 missense probably damaging 0.98
R6336:Slc12a5 UTSW 2 164992464 intron probably null
R6581:Slc12a5 UTSW 2 164987115 missense probably damaging 1.00
R6706:Slc12a5 UTSW 2 164988589 missense probably damaging 1.00
R6886:Slc12a5 UTSW 2 164982905 missense probably benign
R7134:Slc12a5 UTSW 2 164974958 missense probably damaging 1.00
R7310:Slc12a5 UTSW 2 164992440 missense probably damaging 1.00
R7402:Slc12a5 UTSW 2 164982932 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATGCCCTGGTACAAAGCAG -3'
(R):5'- AACAACCAGTTCCGGCTTAGG -3'

Sequencing Primer
(F):5'- TCCTGGTCTGAGCTCTGGC -3'
(R):5'- CTTAGGTGGCAGGGTCATCAAAC -3'
Posted On2015-11-11