Incidental Mutation 'R0932:Slc12a5'
ID80946
Institutional Source Beutler Lab
Gene Symbol Slc12a5
Ensembl Gene ENSMUSG00000017740
Gene Namesolute carrier family 12, member 5
SynonymsKCC2
MMRRC Submission 039076-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0932 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164960802-164999731 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 164996885 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040381] [ENSMUST00000099092] [ENSMUST00000121377] [ENSMUST00000122070] [ENSMUST00000202223] [ENSMUST00000202479] [ENSMUST00000202623]
Predicted Effect probably benign
Transcript: ENSMUST00000040381
SMART Domains Protein: ENSMUSP00000046388
Gene: ENSMUSG00000039804

DomainStartEndE-ValueType
low complexity region 46 79 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
coiled coil region 163 190 N/A INTRINSIC
SCOP:d1kmma1 195 287 2e-9 SMART
PDB:1V95|A 197 314 3e-79 PDB
low complexity region 324 340 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 395 427 N/A INTRINSIC
low complexity region 440 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099092
SMART Domains Protein: ENSMUSP00000096690
Gene: ENSMUSG00000017740

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 304 5.2e-22 PFAM
Pfam:AA_permease_2 364 632 1e-17 PFAM
Pfam:AA_permease 389 676 1.9e-42 PFAM
Pfam:SLC12 688 814 2.1e-19 PFAM
Pfam:SLC12 807 959 1.8e-20 PFAM
low complexity region 978 1002 N/A INTRINSIC
Pfam:SLC12 1009 1115 2.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121377
SMART Domains Protein: ENSMUSP00000113872
Gene: ENSMUSG00000039804

DomainStartEndE-ValueType
PDB:1V95|A 1 34 2e-15 PDB
low complexity region 44 60 N/A INTRINSIC
low complexity region 87 96 N/A INTRINSIC
low complexity region 115 147 N/A INTRINSIC
low complexity region 160 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122070
SMART Domains Protein: ENSMUSP00000113166
Gene: ENSMUSG00000039804

DomainStartEndE-ValueType
low complexity region 46 79 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
coiled coil region 163 190 N/A INTRINSIC
SCOP:d1kmma1 195 287 1e-8 SMART
PDB:1V95|A 197 314 2e-80 PDB
low complexity region 324 340 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137302
Predicted Effect probably benign
Transcript: ENSMUST00000202223
SMART Domains Protein: ENSMUSP00000143870
Gene: ENSMUSG00000017740

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 1e-19 PFAM
Pfam:AA_permease_2 386 655 4.5e-15 PFAM
Pfam:AA_permease 412 699 3.7e-40 PFAM
Pfam:SLC12 711 837 7.2e-17 PFAM
Pfam:SLC12 830 982 6.2e-18 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1030 1133 8.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202479
SMART Domains Protein: ENSMUSP00000144540
Gene: ENSMUSG00000017740

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 176 5.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202623
SMART Domains Protein: ENSMUSP00000144623
Gene: ENSMUSG00000017740

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 5.3e-22 PFAM
Pfam:AA_permease_2 386 655 1.2e-17 PFAM
Pfam:AA_permease 412 699 2e-42 PFAM
Pfam:SLC12 711 837 2.1e-19 PFAM
Pfam:SLC12 830 982 1.8e-20 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1032 1138 2.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.2%
  • 20x: 97.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within a few minutes of birth of respiratory failure resulting from a motor nerve defect. Mice homozygous for a hypomorphic allele display postnatal lethality and tonic-clonic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,056,107 N47S probably benign Het
AA986860 T C 1: 130,737,693 probably null Het
Akap9 T A 5: 4,046,492 C2456S possibly damaging Het
Anks3 C T 16: 4,953,827 R111H probably damaging Het
Atp1a3 A T 7: 24,987,976 probably null Het
Bahd1 T C 2: 118,915,927 L9P probably damaging Het
Capn12 T C 7: 28,887,698 V364A possibly damaging Het
Cds1 T A 5: 101,797,025 C122S probably damaging Het
Cenpc1 T C 5: 86,037,600 T351A possibly damaging Het
Cuzd1 T C 7: 131,320,194 probably benign Het
Daxx T C 17: 33,910,661 L72P probably damaging Het
Depdc1b A G 13: 108,386,835 I415V probably benign Het
Dlg2 T C 7: 92,375,637 V675A probably damaging Het
Dtx4 A G 19: 12,492,151 V204A probably benign Het
Ganc T C 2: 120,458,129 V872A probably damaging Het
Gm14403 A T 2: 177,507,017 R38W probably benign Het
Gm4553 T C 7: 142,165,686 S2G unknown Het
Gm8159 G A 14: 4,635,226 R148H possibly damaging Het
Gsdmc3 T C 15: 63,858,551 probably null Het
Ibtk C T 9: 85,735,046 G158R probably damaging Het
Irx2 T A 13: 72,631,556 S320T possibly damaging Het
Kctd7 A T 5: 130,151,669 probably null Het
Kdr T C 5: 75,968,805 T141A probably benign Het
Krt25 T A 11: 99,321,283 Q176L possibly damaging Het
Krt71 T C 15: 101,736,760 N372S probably benign Het
Mllt3 A G 4: 87,789,384 V446A probably damaging Het
Olfr1282 A T 2: 111,335,198 D293E probably benign Het
Olfr311 T C 11: 58,841,714 V200A possibly damaging Het
Olfr472 A C 7: 107,903,190 T158P possibly damaging Het
Olfr481 C T 7: 108,081,520 T242M probably damaging Het
Olfr50 T A 2: 36,793,891 Y218* probably null Het
Poldip2 T C 11: 78,512,468 S18P possibly damaging Het
Ptprd T G 4: 76,136,885 Q193P probably damaging Het
Reck C T 4: 43,922,838 T371M possibly damaging Het
Rnf144b G T 13: 47,220,525 R66L probably null Het
Rpn2 T A 2: 157,283,771 D67E possibly damaging Het
Scn11a A G 9: 119,807,810 F275S probably damaging Het
Snapc4 A G 2: 26,374,646 I253T probably damaging Het
Tppp2 C T 14: 51,920,424 probably benign Het
Usp9y A C Y: 1,315,930 N2068K probably benign Het
Vmn2r45 A G 7: 8,475,381 C536R probably damaging Het
Other mutations in Slc12a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Slc12a5 APN 2 164997121 missense probably damaging 1.00
IGL00425:Slc12a5 APN 2 164983281 missense probably damaging 1.00
IGL00976:Slc12a5 APN 2 164979304 missense probably damaging 1.00
IGL01654:Slc12a5 APN 2 164973755 missense possibly damaging 0.91
IGL01905:Slc12a5 APN 2 164990381 missense probably benign 0.02
IGL02205:Slc12a5 APN 2 164996479 missense probably benign 0.03
IGL02510:Slc12a5 APN 2 164982808 splice site probably benign
IGL02746:Slc12a5 APN 2 164974916 missense probably benign 0.01
R0051:Slc12a5 UTSW 2 164986663 missense probably damaging 1.00
R0254:Slc12a5 UTSW 2 164997245 critical splice donor site probably null
R0412:Slc12a5 UTSW 2 164994062 missense probably benign 0.05
R0587:Slc12a5 UTSW 2 164976533 missense probably damaging 1.00
R0835:Slc12a5 UTSW 2 164994038 missense probably damaging 0.97
R1643:Slc12a5 UTSW 2 164994027 missense probably benign 0.01
R1700:Slc12a5 UTSW 2 164992376 missense possibly damaging 0.94
R1760:Slc12a5 UTSW 2 164996128 missense probably damaging 0.99
R2063:Slc12a5 UTSW 2 164997147 missense probably damaging 1.00
R2293:Slc12a5 UTSW 2 164992330 missense probably benign 0.03
R2412:Slc12a5 UTSW 2 164976462 critical splice donor site probably null
R3035:Slc12a5 UTSW 2 164980258 missense probably benign 0.06
R3116:Slc12a5 UTSW 2 164996181 intron probably null
R3412:Slc12a5 UTSW 2 164968431 missense probably benign 0.26
R3788:Slc12a5 UTSW 2 164993775 missense probably damaging 1.00
R4039:Slc12a5 UTSW 2 164992330 missense probably benign 0.03
R4174:Slc12a5 UTSW 2 164979490 missense probably damaging 1.00
R4492:Slc12a5 UTSW 2 164979343 missense probably benign 0.08
R4608:Slc12a5 UTSW 2 164973765 missense probably damaging 0.99
R4750:Slc12a5 UTSW 2 164982931 missense probably benign 0.06
R4994:Slc12a5 UTSW 2 164983365 intron probably null
R5103:Slc12a5 UTSW 2 164992433 missense probably damaging 1.00
R5539:Slc12a5 UTSW 2 164987206 missense possibly damaging 0.94
R5632:Slc12a5 UTSW 2 164987221 missense possibly damaging 0.86
R5771:Slc12a5 UTSW 2 164973768 missense possibly damaging 0.88
R6139:Slc12a5 UTSW 2 164992311 missense probably damaging 0.98
R6336:Slc12a5 UTSW 2 164992464 intron probably null
R6581:Slc12a5 UTSW 2 164987115 missense probably damaging 1.00
R6706:Slc12a5 UTSW 2 164988589 missense probably damaging 1.00
R6886:Slc12a5 UTSW 2 164982905 missense probably benign
R7134:Slc12a5 UTSW 2 164974958 missense probably damaging 1.00
R7310:Slc12a5 UTSW 2 164992440 missense probably damaging 1.00
R7402:Slc12a5 UTSW 2 164982932 missense probably benign 0.01
R8079:Slc12a5 UTSW 2 164992452 missense probably damaging 1.00
R8301:Slc12a5 UTSW 2 164993691 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTTTCCCCAGTTCGAGACTTACAG -3'
(R):5'- CCAAGAAGAGTTAGGTCGGATCGC -3'

Sequencing Primer
(F):5'- TTCCAGGTCAGGATGCACTC -3'
(R):5'- TTAGGTCGGATCGCCCTCC -3'
Posted On2013-11-07