Mutagenetix > Incidental Mutations

Incidental Mutation 'R4750:Apaf1'

357511

Institutional Source

Beutler Lab

Gene Symbol

Apaf1

Ensembl Gene

ENSMUSG00000019979

Gene Name

apoptotic peptidase activating factor 1

Synonyms

Apaf1l, 6230400I06Rik

MMRRC Submission

042031-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4750 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90989311-91082770 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 91060188 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 341 (R341G)

Ref Sequence

ENSEMBL: ENSMUSP00000124134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020157] [ENSMUST00000159110] [ENSMUST00000162618]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020157
AA Change: R352G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020157
Gene: ENSMUSG00000019979
AA Change: R352G

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	7.3e-22	PFAM
Pfam:NB-ARC	129	414	1.7e-77	PFAM
WD40	604	643	1.35e-5	SMART
WD40	646	685	1.04e-11	SMART
WD40	688	729	2.98e-7	SMART
WD40	732	771	9.88e-13	SMART
WD40	780	825	1.28e1	SMART
WD40	828	868	1.43e0	SMART
WD40	871	910	3.24e-8	SMART
WD40	952	989	2.57e0	SMART
WD40	992	1031	1.09e-5	SMART
WD40	1033	1071	2.09e-2	SMART
WD40	1074	1113	2.93e-6	SMART
WD40	1116	1155	8.55e-8	SMART
WD40	1168	1204	4.55e-3	SMART
Blast:WD40	1207	1246	5e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000159110
AA Change: R352G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125291
Gene: ENSMUSG00000019979
AA Change: R352G

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	7.4e-21	PFAM
Pfam:NB-ARC	129	414	6.9e-71	PFAM
WD40	604	643	1.35e-5	SMART
WD40	646	685	1.04e-11	SMART
WD40	688	729	2.98e-7	SMART
WD40	732	771	9.88e-13	SMART
WD40	780	825	1.28e1	SMART
WD40	828	868	1.43e0	SMART
WD40	871	910	3.24e-8	SMART
WD40	952	989	2.57e0	SMART
WD40	992	1031	1.09e-5	SMART
WD40	1033	1071	2.09e-2	SMART
WD40	1074	1113	2.93e-6	SMART
WD40	1116	1155	8.55e-8	SMART
WD40	1168	1204	4.55e-3	SMART
Blast:WD40	1207	1246	5e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000162618
AA Change: R341G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124134
Gene: ENSMUSG00000019979
AA Change: R341G

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	1.1e-20	PFAM
Pfam:NB-ARC	118	403	8.8e-72	PFAM
WD40	593	632	1.35e-5	SMART
WD40	635	674	1.04e-11	SMART
WD40	677	718	2.98e-7	SMART
WD40	721	760	9.88e-13	SMART
WD40	769	814	1.28e1	SMART
WD40	817	857	1.43e0	SMART
WD40	860	899	3.24e-8	SMART
WD40	941	978	2.57e0	SMART
WD40	981	1020	1.09e-5	SMART
WD40	1022	1060	2.09e-2	SMART
WD40	1063	1102	2.93e-6	SMART
WD40	1105	1144	8.55e-8	SMART
WD40	1157	1193	4.55e-3	SMART
Blast:WD40	1196	1235	5e-18	BLAST

Meta Mutation Damage Score

0.2051

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

97% (89/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects in apoptosis resulting in brain overgrowth, craniofacial defects, interdigit webbing and altered lens and retina. Most mutants die by embryonic day 16.5 or perinatally, and male survivors are sterile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008P14Rik	C	T	2: 32,379,413		probably null	Het
1700074P13Rik	A	G	6: 40,921,021	W243R	probably damaging	Het
2510039O18Rik	T	A	4: 147,941,488	L155Q	probably damaging	Het
Aadac	T	C	3: 60,035,817	F48L	probably benign	Het
Aadat	T	A	8: 60,526,600	N165K	probably benign	Het
Acan	C	A	7: 79,092,718	D557E	probably damaging	Het
Adamts4	T	A	1: 171,251,066	V85D	probably benign	Het
Agt	A	G	8: 124,556,937	V481A	probably benign	Het
Angpt1	T	C	15: 42,676,401	N21D	probably benign	Het
Ankrd52	A	C	10: 128,378,089	D38A	probably damaging	Het
Ap1g2	G	T	14: 55,104,365	Q247K	probably damaging	Het
Arf2	T	C	11: 103,979,759		probably null	Het
Arhgef1	A	G	7: 24,918,576		probably benign	Het
Bbox1	T	A	2: 110,265,521	Y366F	possibly damaging	Het
Bmp3	A	G	5: 98,872,558	E280G	possibly damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cdh12	T	A	15: 21,583,808	V578D	possibly damaging	Het
Cdk19	T	C	10: 40,476,199	S282P	probably damaging	Het
Cfap46	A	G	7: 139,679,323		probably null	Het
Cfhr3	T	A	1: 139,584,828		noncoding transcript	Het
Ctrc	T	A	4: 141,841,523	Y123F	probably benign	Het
Enpp4	A	G	17: 44,102,355	M96T	probably damaging	Het
Exosc10	T	A	4: 148,562,394	S154T	possibly damaging	Het
Fbxo21	G	A	5: 118,000,468	R486H	probably benign	Het
Foxj3	C	A	4: 119,616,590	A204E	probably damaging	Het
Gas6	T	G	8: 13,476,227	D237A	probably benign	Het
Gimap8	A	G	6: 48,650,427	S112G	probably benign	Het
Gm4787	T	C	12: 81,378,367	N339S	possibly damaging	Het
Gm6185	T	C	1: 161,182,363		noncoding transcript	Het
Gramd3	A	G	18: 56,432,300	E9G	probably benign	Het
Hmgxb3	A	T	18: 61,167,496	D169E	probably benign	Het
Isl2	T	A	9: 55,544,312	V162D	probably benign	Het
Kcns3	T	A	12: 11,091,654	D348V	probably damaging	Het
Kcp	G	A	6: 29,484,626	P1318S	probably benign	Het
Kif12	T	A	4: 63,167,783	Q415L	probably damaging	Het
Lama3	T	A	18: 12,504,359	H45Q	probably benign	Het
Lonp2	A	T	8: 86,631,502	K117M	probably benign	Het
Loxl4	T	A	19: 42,605,004	N243Y	probably damaging	Het
Lrif1	C	A	3: 106,735,564	Q662K	probably benign	Het
Lrrc37a	T	A	11: 103,455,480	I3187L	probably benign	Het
Lsg1	A	G	16: 30,565,449	I521T	probably damaging	Het
Mecom	T	G	3: 29,957,530	K865Q	probably damaging	Het
Myh10	T	C	11: 68,785,314	I790T	probably damaging	Het
Nek7	C	T	1: 138,498,673	S234N	probably damaging	Het
Nepro	T	C	16: 44,730,182	L179P	probably damaging	Het
Nexn	A	G	3: 152,237,722	C649R	probably damaging	Het
Nsmf	T	C	2: 25,055,026	S34P	probably damaging	Het
Olfr1140	C	T	2: 87,746,508	T104I	probably benign	Het
Olfr1339	T	A	4: 118,734,733	V68D	possibly damaging	Het
Olfr1350	A	G	7: 6,570,851	I287V	probably benign	Het
Olfr1364	A	G	13: 21,573,743	S238P	possibly damaging	Het
Olfr354	T	A	2: 36,907,716	S257T	probably benign	Het
Olfr406	T	A	11: 74,269,420	F10L	probably benign	Het
Olfr417	A	G	1: 174,368,922	I2V	probably benign	Het
Olfr685	A	T	7: 105,180,926	I144N	probably damaging	Het
Olfr702	A	G	7: 106,824,307	F73S	probably damaging	Het
P2rx5	G	T	11: 73,164,877	K53N	probably damaging	Het
Pcdhb20	C	A	18: 37,506,131	A570E	possibly damaging	Het
Pip4k2c	T	C	10: 127,211,417	H32R	unknown	Het
Pkhd1	T	A	1: 20,524,112	D1259V	possibly damaging	Het
Plekha7	A	T	7: 116,137,311	V889E	probably damaging	Het
Polr2b	A	C	5: 77,332,039	E546D	possibly damaging	Het
Ppm1l	A	G	3: 69,549,328	T193A	probably damaging	Het
Ppp1r37	G	T	7: 19,531,520	D710E	probably benign	Het
Prdm4	A	G	10: 85,899,221	F679L	probably damaging	Het
Prkcd	A	G	14: 30,610,301	M1T	probably null	Het
Rcor3	A	G	1: 192,130,449	Y77H	unknown	Het
Rdh5	T	C	10: 128,918,366	E66G	possibly damaging	Het
Slc12a5	A	G	2: 164,982,931	M396V	probably benign	Het
Slco5a1	T	G	1: 12,879,280	T629P	probably damaging	Het
Smarca5	A	C	8: 80,733,707	N133K	probably benign	Het
Spag5	T	C	11: 78,320,052	M927T	probably benign	Het
Spint4	A	T	2: 164,700,146	D39V	probably damaging	Het
Syt6	T	A	3: 103,630,917	*512R	probably null	Het
Tmem247	T	C	17: 86,922,342	C204R	probably damaging	Het
Tmem72	A	G	6: 116,695,434	Y149H	probably damaging	Het
Trpm6	T	C	19: 18,876,064	V1816A	probably damaging	Het
Usp35	A	G	7: 97,310,339	V1008A	possibly damaging	Het
Washc4	T	C	10: 83,591,052	S1075P	probably damaging	Het
Wdr34	T	C	2: 30,033,920	T198A	probably benign	Het
Xylb	G	T	9: 119,359,313	G62*	probably null	Het
Zfp142	T	C	1: 74,572,458	E623G	probably damaging	Het
Zfp239	A	G	6: 117,871,739	Y146C	probably damaging	Het

Other mutations in Apaf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Apaf1	APN	10	91023788	missense	probably damaging	0.99
IGL00819:Apaf1	APN	10	90997340	splice site	probably null
IGL01481:Apaf1	APN	10	91031588	missense	possibly damaging	0.84
IGL01713:Apaf1	APN	10	91061832	splice site	probably benign
IGL01715:Apaf1	APN	10	91058354	missense	probably benign	0.20
IGL02152:Apaf1	APN	10	91061819	missense	probably benign	0.24
IGL02331:Apaf1	APN	10	91059619	missense	probably damaging	1.00
IGL03071:Apaf1	APN	10	90997255	missense	possibly damaging	0.88
IGL03101:Apaf1	APN	10	91031559	missense	possibly damaging	0.89
IGL03244:Apaf1	APN	10	91049349	splice site	probably benign
Mayhem	UTSW	10	90999719	missense	probably damaging	0.99
Wipeout	UTSW	10	91056000	missense	probably damaging	1.00
R0520:Apaf1	UTSW	10	91079989	missense	probably damaging	0.99
R0600:Apaf1	UTSW	10	91060052	missense	probably damaging	1.00
R0607:Apaf1	UTSW	10	91009203	missense	probably damaging	1.00
R0688:Apaf1	UTSW	10	91061705	missense	possibly damaging	0.94
R0734:Apaf1	UTSW	10	91037021	missense	probably benign	0.02
R1256:Apaf1	UTSW	10	91058406	missense	probably benign
R1459:Apaf1	UTSW	10	91062160	missense	probably benign	0.00
R1485:Apaf1	UTSW	10	91060243	missense	probably benign	0.02
R1511:Apaf1	UTSW	10	91060185	missense	possibly damaging	0.81
R1531:Apaf1	UTSW	10	91054521	missense	probably damaging	1.00
R1705:Apaf1	UTSW	10	91067271	splice site	probably benign
R1919:Apaf1	UTSW	10	91077614	nonsense	probably null
R1925:Apaf1	UTSW	10	90999719	missense	probably damaging	0.99
R2001:Apaf1	UTSW	10	91061814	missense	possibly damaging	0.94
R2002:Apaf1	UTSW	10	91061814	missense	possibly damaging	0.94
R2006:Apaf1	UTSW	10	91061772	missense	probably damaging	1.00
R2043:Apaf1	UTSW	10	91037028	missense	probably damaging	1.00
R2073:Apaf1	UTSW	10	91031694	nonsense	probably null
R2101:Apaf1	UTSW	10	91060080	missense	probably benign	0.26
R2130:Apaf1	UTSW	10	91060165	nonsense	probably null
R2153:Apaf1	UTSW	10	91048090	missense	probably damaging	1.00
R2377:Apaf1	UTSW	10	91079893	missense	possibly damaging	0.95
R2421:Apaf1	UTSW	10	91020723	missense	probably damaging	1.00
R3835:Apaf1	UTSW	10	91059587	missense	probably benign	0.07
R5100:Apaf1	UTSW	10	90997287	missense	probably benign
R5135:Apaf1	UTSW	10	91060094	missense	probably damaging	1.00
R5497:Apaf1	UTSW	10	90999656	missense	probably damaging	1.00
R5511:Apaf1	UTSW	10	91054392	missense	probably damaging	1.00
R5659:Apaf1	UTSW	10	91062153	nonsense	probably null
R5730:Apaf1	UTSW	10	91020771	missense	possibly damaging	0.62
R6176:Apaf1	UTSW	10	91059571	critical splice donor site	probably null
R6242:Apaf1	UTSW	10	91062163	missense	probably damaging	1.00
R6292:Apaf1	UTSW	10	90991563	missense	possibly damaging	0.86
R6376:Apaf1	UTSW	10	91023811	missense	probably damaging	1.00
R6534:Apaf1	UTSW	10	91056000	missense	probably damaging	1.00
R6975:Apaf1	UTSW	10	91020734	missense	probably damaging	0.97
R7218:Apaf1	UTSW	10	91037002	missense	probably damaging	1.00
R7369:Apaf1	UTSW	10	91001036	missense	probably damaging	0.97
R7409:Apaf1	UTSW	10	91067246	missense	probably damaging	1.00
R7413:Apaf1	UTSW	10	90995680	missense	probably benign	0.28
R7418:Apaf1	UTSW	10	91023835	missense	probably benign	0.09
R7423:Apaf1	UTSW	10	91059606	missense	probably damaging	1.00
R7488:Apaf1	UTSW	10	91054380	missense	probably benign	0.35
R7765:Apaf1	UTSW	10	91023782	missense	probably benign	0.34
R7913:Apaf1	UTSW	10	91060271	missense	probably damaging	0.99
R7914:Apaf1	UTSW	10	91060233	missense	probably damaging	1.00
R7922:Apaf1	UTSW	10	90999753	missense	probably benign
R8131:Apaf1	UTSW	10	91077558	missense	possibly damaging	0.93
R8158:Apaf1	UTSW	10	91059658	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- ATGCCATAAGGACCCAGTGATAAG -3'
(R):5'- ACACACTTGGAGCACGTAGG -3'

Sequencing Primer
(F):5'- ATAAGGAGGGCGGGTTGTCC -3'
(R):5'- CACTTGGAGCACGTAGGGAGAG -3'

Posted On

2015-11-11