Mutagenetix > Incidental Mutation

Incidental Mutation 'R4798:Gabbr2'

369193

Institutional Source

Beutler Lab

Gene Symbol

Gabbr2

Ensembl Gene

ENSMUSG00000039809

Gene Name

gamma-aminobutyric acid (GABA) B receptor, 2

Synonyms

Gpr51, Gababr2, LOC242425

MMRRC Submission

042422-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R4798 (G1)

Quality Score

158

Status

Validated

Chromosome

Chromosomal Location

46662305-46991873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 46991139 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Serine at position 96 (Y96S)

Ref Sequence

ENSEMBL: ENSMUSP00000103378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107749]

AlphaFold

Q80T41

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107749
AA Change: Y96S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000103378
Gene: ENSMUSG00000039809
AA Change: Y96S

Domain	Start	End	E-Value	Type
signal peptide	1	40	N/A	INTRINSIC
Pfam:Peripla_BP_6	59	434	1.5e-15	PFAM
Pfam:ANF_receptor	75	429	2e-51	PFAM
Pfam:7tm_3	492	745	6.4e-57	PFAM
PDB:4PAS\|B	778	818	1e-18	PDB

Meta Mutation Damage Score

0.6887

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

97% (111/114)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in clonic seizures, hyperactivity, hyperalgesia in response to thermal or mechanical stimuli, increased anxiety, and decreased depression-related behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,624,965	D617E	probably benign	Het
2210408I21Rik	T	C	13: 77,323,724	W1083R	possibly damaging	Het
Adamts10	T	A	17: 33,528,752	L54Q	probably damaging	Het
Ankrd24	A	C	10: 81,643,315		probably benign	Het
Atg2b	A	G	12: 105,652,629	S813P	probably benign	Het
Atp13a3	T	A	16: 30,341,240	I716F	probably damaging	Het
Atp6v1c1	T	A	15: 38,689,176	W294R	probably damaging	Het
Atrnl1	G	T	19: 58,042,361	A1312S	probably benign	Het
B230359F08Rik	T	A	14: 53,795,951	C106S	probably damaging	Het
Bcl2	A	T	1: 106,712,608	H91Q	possibly damaging	Het
Cacna1c	G	A	6: 118,630,302	Q1214*	probably null	Het
Cacna1g	C	A	11: 94,433,847	G1183W	probably damaging	Het
Capsl	A	T	15: 9,461,742	M75L	probably benign	Het
Ccdc122	T	G	14: 77,111,607		probably benign	Het
Ccdc57	T	G	11: 120,881,857	R645S	possibly damaging	Het
Cdh8	T	A	8: 99,024,926	R720*	probably null	Het
Cenpx	T	G	11: 120,711,784		probably benign	Het
Clic3	T	C	2: 25,458,182	S114P	probably damaging	Het
Crtac1	A	T	19: 42,323,801	W158R	possibly damaging	Het
Dhrs11	T	A	11: 84,828,800	Q33L	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dpp9	G	T	17: 56,191,016	Q647K	probably damaging	Het
Egf	C	T	3: 129,716,678	G64D	probably damaging	Het
Eif2b4	C	T	5: 31,189,520		probably benign	Het
Epas1	A	G	17: 86,805,839	N151S	probably benign	Het
Fastkd1	A	T	2: 69,691,307	I707K	probably benign	Het
Fbln2	A	G	6: 91,269,186	T1005A	probably benign	Het
Fgfrl1	T	A	5: 108,703,497	Y93*	probably null	Het
Fktn	A	G	4: 53,744,637	T306A	probably benign	Het
Gm16332	A	T	1: 139,891,658		noncoding transcript	Het
Gm5145	G	T	17: 20,570,548	V63F	probably damaging	Het
Gm9970	G	T	5: 31,241,085		probably benign	Het
Gpr158	A	G	2: 21,783,182	T545A	probably damaging	Het
Heatr1	G	A	13: 12,412,048	E685K	probably benign	Het
Herc6	A	T	6: 57,604,166	I284F	probably damaging	Het
Hook1	C	G	4: 96,002,557	A301G	possibly damaging	Het
Hpcal4	T	A	4: 123,190,698	M140K	possibly damaging	Het
Il11ra1	T	C	4: 41,766,096		probably benign	Het
Ildr1	A	T	16: 36,722,555	H439L	possibly damaging	Het
Itga11	A	G	9: 62,776,727		probably null	Het
Jag2	A	T	12: 112,916,632	D337E	probably benign	Het
Krt82	C	T	15: 101,550,488	R39Q	probably benign	Het
L3mbtl4	T	A	17: 68,359,480	M1K	probably null	Het
Lrrc32	T	G	7: 98,499,017	F335V	probably damaging	Het
Lurap1l	T	A	4: 80,911,413	V20E	probably damaging	Het
Lyar	T	A	5: 38,227,886	V90D	possibly damaging	Het
Man2c1	C	T	9: 57,141,185	R778*	probably null	Het
Mapk6	A	G	9: 75,388,432	F595L	probably benign	Het
Mccc1	A	G	3: 35,985,001	I281T	probably damaging	Het
Mep1b	T	C	18: 21,093,254	V391A	probably damaging	Het
Mier1	G	A	4: 103,130,998	D40N	probably damaging	Het
Mkx	T	C	18: 7,002,432	H38R	probably benign	Het
Mroh4	A	G	15: 74,626,179	L184P	probably damaging	Het
Muc2	C	A	7: 141,754,140	N834K	probably benign	Het
Mycl	A	G	4: 123,000,256	D283G	probably damaging	Het
Myh6	T	C	14: 54,953,293	N975S	probably damaging	Het
Myl12a	A	G	17: 70,996,302		probably benign	Het
Mysm1	T	C	4: 94,965,673	T230A	probably benign	Het
Naca	A	G	10: 128,047,803	K2099R	probably null	Het
Nbeal1	T	G	1: 60,222,193		probably null	Het
Nedd1	A	G	10: 92,698,910	V246A	probably benign	Het
Nid2	A	G	14: 19,789,761	D806G	probably benign	Het
Ninl	G	A	2: 150,959,881	R156*	probably null	Het
Obscn	T	A	11: 59,069,859	I3418F	probably damaging	Het
Olfr970	T	A	9: 39,819,897	V86E	probably benign	Het
Pappa2	T	C	1: 158,857,379	N730S	probably damaging	Het
Pcm1	G	A	8: 41,293,678	D1305N	probably damaging	Het
Pcsk4	A	T	10: 80,323,104	I485N	probably damaging	Het
Phldb2	T	C	16: 45,825,874	R111G	probably damaging	Het
Prdm10	T	C	9: 31,341,273	F385S	probably damaging	Het
Prkcsh	C	T	9: 22,011,738	P351L	probably damaging	Het
Prrc2a	G	A	17: 35,150,042	P2006L	probably damaging	Het
Rad51c	T	C	11: 87,395,378	D251G	probably damaging	Het
Radil	A	G	5: 142,485,163	F1088L	probably benign	Het
Rere	C	A	4: 150,615,167		probably benign	Het
Rnf167	T	A	11: 70,650,135	C196S	probably benign	Het
Robo2	T	A	16: 74,352,745	Y65F	probably damaging	Het
Scarf2	G	A	16: 17,803,507	C319Y	probably damaging	Het
Sec24c	A	G	14: 20,693,712	D995G	probably damaging	Het
Selenbp1	T	C	3: 94,943,900	L369S	probably benign	Het
Sgpl1	A	T	10: 61,123,344	I53K	possibly damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc1a6	A	T	10: 78,800,118	Y339F	probably damaging	Het
Smchd1	G	T	17: 71,360,053	Y1781*	probably null	Het
Smg1	T	C	7: 118,180,474	S1233G	probably benign	Het
Snap91	A	T	9: 86,783,454		probably benign	Het
Snx29	T	A	16: 11,420,736	L112Q	probably damaging	Het
Sptbn5	T	C	2: 120,059,141		probably benign	Het
Srl	A	T	16: 4,492,358	H502Q	possibly damaging	Het
St5	C	T	7: 109,557,033	G170D	probably damaging	Het
St8sia3	A	G	18: 64,271,749	M366V	probably benign	Het
Stk19	A	T	17: 34,822,509		probably benign	Het
Syngap1	G	A	17: 26,961,449	A611T	probably benign	Het
Tas2r113	A	G	6: 132,893,707	T233A	possibly damaging	Het
Tbcc	G	A	17: 46,891,219	W177*	probably null	Het
Tcstv3	T	A	13: 120,318,082		probably null	Het
Trmt61a	G	A	12: 111,678,713	V28M	possibly damaging	Het
Ubap2l	G	A	3: 90,020,903	T553M	probably damaging	Het
Urb1	T	C	16: 90,757,827	N1839S	probably benign	Het
Ush2a	T	C	1: 188,743,545	L2893P	probably damaging	Het
Usp24	G	A	4: 106,360,162	V421M	possibly damaging	Het
Vmn1r43	T	C	6: 89,869,910	E198G	probably benign	Het
Vps13d	A	C	4: 145,178,056	S130A	probably damaging	Het
Zfp426	T	A	9: 20,471,014	I211F	probably benign	Het
Znfx1	T	C	2: 167,038,569		probably null	Het

Other mutations in Gabbr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Gabbr2	APN	4	46787600	missense	probably damaging	1.00
IGL00844:Gabbr2	APN	4	46875711	missense	probably damaging	1.00
IGL01584:Gabbr2	APN	4	46674524	missense	probably damaging	0.97
IGL01684:Gabbr2	APN	4	46736501	missense	probably benign
IGL01884:Gabbr2	APN	4	46875711	missense	probably damaging	1.00
IGL02073:Gabbr2	APN	4	46667547	missense	probably benign	0.00
IGL02376:Gabbr2	APN	4	46684300	missense	probably damaging	1.00
R0194:Gabbr2	UTSW	4	46787565	missense	possibly damaging	0.48
R0627:Gabbr2	UTSW	4	46681223	missense	possibly damaging	0.92
R0685:Gabbr2	UTSW	4	46787521	missense	possibly damaging	0.64
R0781:Gabbr2	UTSW	4	46718838	missense	probably damaging	1.00
R0882:Gabbr2	UTSW	4	46718904	missense	probably damaging	1.00
R0883:Gabbr2	UTSW	4	46677474	missense	probably benign	0.00
R1004:Gabbr2	UTSW	4	46677544	missense	possibly damaging	0.60
R1078:Gabbr2	UTSW	4	46664833	missense	probably damaging	0.99
R1110:Gabbr2	UTSW	4	46718838	missense	probably damaging	1.00
R1368:Gabbr2	UTSW	4	46674464	missense	probably benign	0.31
R1557:Gabbr2	UTSW	4	46846436	missense	probably damaging	1.00
R1577:Gabbr2	UTSW	4	46684319	missense	probably benign	0.29
R1645:Gabbr2	UTSW	4	46664963	splice site	probably null
R1743:Gabbr2	UTSW	4	46677603	missense	possibly damaging	0.47
R1848:Gabbr2	UTSW	4	46739823	missense	probably benign	0.31
R1997:Gabbr2	UTSW	4	46787502	missense	probably damaging	1.00
R2009:Gabbr2	UTSW	4	46734119	missense	probably damaging	1.00
R4021:Gabbr2	UTSW	4	46846435	missense	probably damaging	1.00
R4719:Gabbr2	UTSW	4	46718797	missense	probably damaging	0.99
R4757:Gabbr2	UTSW	4	46875675	missense	probably damaging	0.98
R5086:Gabbr2	UTSW	4	46724342	missense	probably damaging	1.00
R5176:Gabbr2	UTSW	4	46681208	missense	probably damaging	0.99
R5451:Gabbr2	UTSW	4	46684294	missense	probably benign	0.15
R5510:Gabbr2	UTSW	4	46734113	missense	probably damaging	1.00
R5611:Gabbr2	UTSW	4	46804105	missense	probably damaging	0.98
R6049:Gabbr2	UTSW	4	46787641	missense	probably damaging	1.00
R6089:Gabbr2	UTSW	4	46846448	missense	probably damaging	1.00
R6118:Gabbr2	UTSW	4	46736459	missense	probably damaging	1.00
R6209:Gabbr2	UTSW	4	46804069	missense	probably damaging	1.00
R6212:Gabbr2	UTSW	4	46681189	missense	probably damaging	0.98
R6717:Gabbr2	UTSW	4	46787574	missense	possibly damaging	0.50
R7339:Gabbr2	UTSW	4	46846340	missense	probably benign	0.01
R7479:Gabbr2	UTSW	4	46681166	missense	probably damaging	0.98
R7695:Gabbr2	UTSW	4	46875687	missense	probably damaging	1.00
R7808:Gabbr2	UTSW	4	46875744	missense	possibly damaging	0.49
R7832:Gabbr2	UTSW	4	46734096	missense	probably benign	0.04
R7993:Gabbr2	UTSW	4	46736349	splice site	probably null
R7994:Gabbr2	UTSW	4	46736349	splice site	probably null
R8051:Gabbr2	UTSW	4	46736349	splice site	probably null
R8084:Gabbr2	UTSW	4	46736349	splice site	probably null
R9050:Gabbr2	UTSW	4	46798659	missense	probably benign	0.03
R9187:Gabbr2	UTSW	4	46674533	missense	probably damaging	1.00
R9622:Gabbr2	UTSW	4	46724283	critical splice donor site	probably null
R9655:Gabbr2	UTSW	4	46815684	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- TCACAGATCAGGGTCCCACC -3'
(R):5'- GGCGTGATTGATCCGTCAC -3'

Sequencing Primer
(F):5'- AGGGTCCCACCTGCTCC -3'
(R):5'- TCTGAGCGAGCAGAAGCC -3'

Posted On

2016-02-04