Incidental Mutation 'R7339:Gabbr2'
ID 569691
Institutional Source Beutler Lab
Gene Symbol Gabbr2
Ensembl Gene ENSMUSG00000039809
Gene Name gamma-aminobutyric acid type B receptor subunit 2
Synonyms Gababr2, Gpr51, LOC242425, GB2
MMRRC Submission 045429-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R7339 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 46662318-46991714 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46846340 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 190 (K190E)
Ref Sequence ENSEMBL: ENSMUSP00000103378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107749]
AlphaFold Q80T41
Predicted Effect probably benign
Transcript: ENSMUST00000107749
AA Change: K190E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000103378
Gene: ENSMUSG00000039809
AA Change: K190E

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:Peripla_BP_6 59 434 1.5e-15 PFAM
Pfam:ANF_receptor 75 429 2e-51 PFAM
Pfam:7tm_3 492 745 6.4e-57 PFAM
PDB:4PAS|B 778 818 1e-18 PDB
Meta Mutation Damage Score 0.1708 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in clonic seizures, hyperactivity, hyperalgesia in response to thermal or mechanical stimuli, increased anxiety, and decreased depression-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,330,938 (GRCm39) D1092G probably benign Het
Abcb11 C T 2: 69,130,211 (GRCm39) D282N probably damaging Het
Ahnak A T 19: 8,985,529 (GRCm39) N2271I possibly damaging Het
Amz1 A G 5: 140,727,306 (GRCm39) S90G probably benign Het
Arhgap5 A G 12: 52,564,481 (GRCm39) E484G possibly damaging Het
Arid3c A G 4: 41,729,883 (GRCm39) probably null Het
Atp1a1 T C 3: 101,497,188 (GRCm39) I373V probably benign Het
Barhl1 T C 2: 28,799,899 (GRCm39) E242G probably damaging Het
Bltp2 G A 11: 78,163,210 (GRCm39) probably null Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,157,152 (GRCm39) probably benign Het
Casz1 T A 4: 149,036,202 (GRCm39) V1488E probably damaging Het
Ccdc175 C A 12: 72,182,815 (GRCm39) Q401H probably damaging Het
Cfap36 T C 11: 29,175,925 (GRCm39) Y191C probably benign Het
Chmp2b G A 16: 65,342,232 (GRCm39) Q119* probably null Het
Cps1 T A 1: 67,236,174 (GRCm39) I969N possibly damaging Het
Dennd5a A G 7: 109,500,366 (GRCm39) F920L probably damaging Het
Dnah12 A T 14: 26,594,277 (GRCm39) T3410S probably benign Het
Fbxo42 T G 4: 140,927,455 (GRCm39) S578R possibly damaging Het
Fcgr1 C T 3: 96,191,615 (GRCm39) G398R not run Het
Foxa3 A T 7: 18,748,794 (GRCm39) Y111N probably damaging Het
Gbp10 T C 5: 105,367,964 (GRCm39) Y403C possibly damaging Het
Hsd3b5 A G 3: 98,529,390 (GRCm39) I80T probably damaging Het
Kri1 T G 9: 21,197,883 (GRCm39) Q89P Het
Lrp6 G T 6: 134,427,781 (GRCm39) P1604T probably damaging Het
Metap1 T C 3: 138,171,898 (GRCm39) probably null Het
Mkrn3 C T 7: 62,069,530 (GRCm39) R87H probably benign Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Myh6 T C 14: 55,199,025 (GRCm39) probably null Het
Naip6 G T 13: 100,452,527 (GRCm39) P178Q probably damaging Het
Ncapg2 A G 12: 116,378,454 (GRCm39) E160G probably damaging Het
Nek6 G A 2: 38,450,977 (GRCm39) A127T probably damaging Het
Nell1 T C 7: 49,929,297 (GRCm39) V264A probably benign Het
Nlrp2 T A 7: 5,330,627 (GRCm39) I590F possibly damaging Het
Or13j1 C T 4: 43,706,080 (GRCm39) A163T probably benign Het
Or2y17 G A 11: 49,231,875 (GRCm39) R172Q not run Het
Or4f57 A T 2: 111,790,956 (GRCm39) M154K probably benign Het
Or4f6 A G 2: 111,838,820 (GRCm39) L237P probably damaging Het
Or52n4b A C 7: 108,144,107 (GRCm39) D125A probably damaging Het
Otop3 T A 11: 115,237,204 (GRCm39) L556Q probably damaging Het
Padi1 T C 4: 140,556,545 (GRCm39) D190G probably null Het
Pald1 T C 10: 61,159,110 (GRCm39) S774G possibly damaging Het
Pde10a C T 17: 8,975,860 (GRCm39) T55I probably benign Het
Pla2g4d T C 2: 120,109,459 (GRCm39) M197V probably benign Het
Prom1 C A 5: 44,258,995 (GRCm39) probably benign Het
Ptdss1 A G 13: 67,111,426 (GRCm39) H164R possibly damaging Het
Rrh A T 3: 129,604,262 (GRCm39) I313N probably damaging Het
Slc35b4 A G 6: 34,144,591 (GRCm39) I88T probably damaging Het
Slc38a11 C T 2: 65,156,914 (GRCm39) V353I probably benign Het
Spata31e3 A T 13: 50,401,204 (GRCm39) I374N possibly damaging Het
Spdef T A 17: 27,939,219 (GRCm39) E42D probably benign Het
Tgoln1 G C 6: 72,593,261 (GRCm39) T73R probably benign Het
Tmx1 A G 12: 70,505,624 (GRCm39) D129G probably benign Het
Trav13n-4 A T 14: 53,601,435 (GRCm39) Y68F probably benign Het
Trp53 T C 11: 69,480,015 (GRCm39) S238P probably damaging Het
Trp53bp1 T C 2: 121,066,950 (GRCm39) D592G probably benign Het
Ttll5 T C 12: 85,904,238 (GRCm39) probably null Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vmn2r43 A T 7: 8,258,306 (GRCm39) Y302* probably null Het
Vps13d C T 4: 144,847,938 (GRCm39) V2478I Het
Vps35l A T 7: 118,409,194 (GRCm39) I612F probably damaging Het
Wsb1 A G 11: 79,131,184 (GRCm39) V404A probably damaging Het
Zfc3h1 A G 10: 115,239,205 (GRCm39) D539G probably damaging Het
Zfp318 T C 17: 46,722,173 (GRCm39) V1392A probably damaging Het
Other mutations in Gabbr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Gabbr2 APN 4 46,787,600 (GRCm39) missense probably damaging 1.00
IGL00844:Gabbr2 APN 4 46,875,711 (GRCm39) missense probably damaging 1.00
IGL01584:Gabbr2 APN 4 46,674,524 (GRCm39) missense probably damaging 0.97
IGL01684:Gabbr2 APN 4 46,736,501 (GRCm39) missense probably benign
IGL01884:Gabbr2 APN 4 46,875,711 (GRCm39) missense probably damaging 1.00
IGL02073:Gabbr2 APN 4 46,667,547 (GRCm39) missense probably benign 0.00
IGL02376:Gabbr2 APN 4 46,684,300 (GRCm39) missense probably damaging 1.00
R0194:Gabbr2 UTSW 4 46,787,565 (GRCm39) missense possibly damaging 0.48
R0627:Gabbr2 UTSW 4 46,681,223 (GRCm39) missense possibly damaging 0.92
R0685:Gabbr2 UTSW 4 46,787,521 (GRCm39) missense possibly damaging 0.64
R0781:Gabbr2 UTSW 4 46,718,838 (GRCm39) missense probably damaging 1.00
R0882:Gabbr2 UTSW 4 46,718,904 (GRCm39) missense probably damaging 1.00
R0883:Gabbr2 UTSW 4 46,677,474 (GRCm39) missense probably benign 0.00
R1004:Gabbr2 UTSW 4 46,677,544 (GRCm39) missense possibly damaging 0.60
R1078:Gabbr2 UTSW 4 46,664,833 (GRCm39) missense probably damaging 0.99
R1110:Gabbr2 UTSW 4 46,718,838 (GRCm39) missense probably damaging 1.00
R1368:Gabbr2 UTSW 4 46,674,464 (GRCm39) missense probably benign 0.31
R1557:Gabbr2 UTSW 4 46,846,436 (GRCm39) missense probably damaging 1.00
R1577:Gabbr2 UTSW 4 46,684,319 (GRCm39) missense probably benign 0.29
R1645:Gabbr2 UTSW 4 46,664,963 (GRCm39) splice site probably null
R1743:Gabbr2 UTSW 4 46,677,603 (GRCm39) missense possibly damaging 0.47
R1848:Gabbr2 UTSW 4 46,739,823 (GRCm39) missense probably benign 0.31
R1997:Gabbr2 UTSW 4 46,787,502 (GRCm39) missense probably damaging 1.00
R2009:Gabbr2 UTSW 4 46,734,119 (GRCm39) missense probably damaging 1.00
R4021:Gabbr2 UTSW 4 46,846,435 (GRCm39) missense probably damaging 1.00
R4719:Gabbr2 UTSW 4 46,718,797 (GRCm39) missense probably damaging 0.99
R4757:Gabbr2 UTSW 4 46,875,675 (GRCm39) missense probably damaging 0.98
R4798:Gabbr2 UTSW 4 46,991,139 (GRCm39) missense possibly damaging 0.92
R5086:Gabbr2 UTSW 4 46,724,342 (GRCm39) missense probably damaging 1.00
R5176:Gabbr2 UTSW 4 46,681,208 (GRCm39) missense probably damaging 0.99
R5451:Gabbr2 UTSW 4 46,684,294 (GRCm39) missense probably benign 0.15
R5510:Gabbr2 UTSW 4 46,734,113 (GRCm39) missense probably damaging 1.00
R5611:Gabbr2 UTSW 4 46,804,105 (GRCm39) missense probably damaging 0.98
R6049:Gabbr2 UTSW 4 46,787,641 (GRCm39) missense probably damaging 1.00
R6089:Gabbr2 UTSW 4 46,846,448 (GRCm39) missense probably damaging 1.00
R6118:Gabbr2 UTSW 4 46,736,459 (GRCm39) missense probably damaging 1.00
R6209:Gabbr2 UTSW 4 46,804,069 (GRCm39) missense probably damaging 1.00
R6212:Gabbr2 UTSW 4 46,681,189 (GRCm39) missense probably damaging 0.98
R6717:Gabbr2 UTSW 4 46,787,574 (GRCm39) missense possibly damaging 0.50
R7479:Gabbr2 UTSW 4 46,681,166 (GRCm39) missense probably damaging 0.98
R7695:Gabbr2 UTSW 4 46,875,687 (GRCm39) missense probably damaging 1.00
R7808:Gabbr2 UTSW 4 46,875,744 (GRCm39) missense possibly damaging 0.49
R7832:Gabbr2 UTSW 4 46,734,096 (GRCm39) missense probably benign 0.04
R7993:Gabbr2 UTSW 4 46,736,349 (GRCm39) splice site probably null
R7994:Gabbr2 UTSW 4 46,736,349 (GRCm39) splice site probably null
R8051:Gabbr2 UTSW 4 46,736,349 (GRCm39) splice site probably null
R8084:Gabbr2 UTSW 4 46,736,349 (GRCm39) splice site probably null
R9050:Gabbr2 UTSW 4 46,798,659 (GRCm39) missense probably benign 0.03
R9187:Gabbr2 UTSW 4 46,674,533 (GRCm39) missense probably damaging 1.00
R9622:Gabbr2 UTSW 4 46,724,283 (GRCm39) critical splice donor site probably null
R9655:Gabbr2 UTSW 4 46,815,684 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGCGTTCTAGATGGATGAATGC -3'
(R):5'- TGTGCCAAGAGAGAAATGCC -3'

Sequencing Primer
(F):5'- CGTTCTAGATGGATGAATGCTAGAGC -3'
(R):5'- ATGCCTGCCTTTAAAGACCATG -3'
Posted On 2019-09-13