Incidental Mutation 'R4906:Arrb2'
ID378218
Institutional Source Beutler Lab
Gene Symbol Arrb2
Ensembl Gene ENSMUSG00000060216
Gene Namearrestin, beta 2
Synonymsbeta arr2, beta-arrestin-2, beta-arrestin2
MMRRC Submission 042508-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4906 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70432635-70440828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70439899 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 374 (D374G)
Ref Sequence ENSEMBL: ENSMUSP00000082018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079056] [ENSMUST00000084954] [ENSMUST00000102563] [ENSMUST00000102564] [ENSMUST00000108568] [ENSMUST00000124943] [ENSMUST00000128748] [ENSMUST00000150076]
Predicted Effect probably benign
Transcript: ENSMUST00000079056
AA Change: D389G

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000078065
Gene: ENSMUSG00000060216
AA Change: D389G

DomainStartEndE-ValueType
Pfam:Arrestin_N 19 175 8.3e-37 PFAM
Arrestin_C 195 350 5.2e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084954
AA Change: D374G

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082018
Gene: ENSMUSG00000060216
AA Change: D374G

DomainStartEndE-ValueType
Pfam:Arrestin_N 36 160 1.7e-25 PFAM
Arrestin_C 180 335 6.53e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102563
AA Change: D378G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099623
Gene: ENSMUSG00000060216
AA Change: D378G

DomainStartEndE-ValueType
Pfam:Arrestin_N 19 175 1.5e-36 PFAM
Arrestin_C 195 350 6.53e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102564
AA Change: D378G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099624
Gene: ENSMUSG00000060216
AA Change: D378G

DomainStartEndE-ValueType
Pfam:Arrestin_N 19 175 1.5e-36 PFAM
Arrestin_C 195 350 6.53e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108568
AA Change: D389G

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104208
Gene: ENSMUSG00000060216
AA Change: D389G

DomainStartEndE-ValueType
Pfam:Arrestin_N 19 175 2.6e-34 PFAM
Arrestin_C 195 350 5.1e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124112
Predicted Effect probably benign
Transcript: ENSMUST00000124943
SMART Domains Protein: ENSMUSP00000136978
Gene: ENSMUSG00000060216

DomainStartEndE-ValueType
Pfam:Arrestin_N 4 83 6.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125441
Predicted Effect probably benign
Transcript: ENSMUST00000128748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184275
Predicted Effect probably benign
Transcript: ENSMUST00000150076
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 2, like arrestin beta 1, was shown to inhibit beta-adrenergic receptor function in vitro. It is expressed at high levels in the central nervous system and may play a role in the regulation of synaptic receptors. Besides the brain, a cDNA for arrestin beta 2 was isolated from thyroid gland, and thus it may also be involved in hormone-specific desensitization of TSH receptors. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced morphine analgesia, an enhanced inflammatory response and reduced threshold to lethal endotoxin challenge, and impaired T and B lymphocyte chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T C 7: 107,624,690 probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adgrf2 T C 17: 42,711,193 I247V probably benign Het
Adgrv1 A G 13: 81,270,738 probably null Het
Ankrd22 T A 19: 34,149,352 K26I possibly damaging Het
Arhgap32 T A 9: 32,245,256 probably null Het
Armc10 A G 5: 21,661,524 Y262C probably damaging Het
Ascc3 C T 10: 50,749,131 R1675C probably damaging Het
Atg5 T C 10: 44,363,050 *276R probably null Het
Bcl11b G A 12: 107,916,709 T377M probably damaging Het
C1s2 C A 6: 124,635,114 E104* probably null Het
Carf A T 1: 60,141,367 H316L probably damaging Het
Ccdc77 A T 6: 120,334,835 I234N probably damaging Het
Cd300c2 A T 11: 114,997,000 V192E possibly damaging Het
Cep72 G A 13: 74,059,465 R62C probably damaging Het
Clasp1 T A 1: 118,508,910 L308* probably null Het
Clec2g A G 6: 128,979,448 S25G probably benign Het
Cngb1 T C 8: 95,251,973 M1046V probably damaging Het
Cobll1 A T 2: 65,097,693 D1095E probably benign Het
Cpeb2 A G 5: 43,244,662 H662R possibly damaging Het
Cps1 A T 1: 67,139,763 T45S probably benign Het
Cspp1 A G 1: 10,082,328 Q368R possibly damaging Het
Dcaf6 C A 1: 165,411,463 probably null Het
Dcst1 T C 3: 89,350,507 Y652C possibly damaging Het
Elf5 T G 2: 103,449,573 Y225* probably null Het
Ermap A C 4: 119,188,818 probably benign Het
Fam186b A T 15: 99,271,321 V915D probably damaging Het
Fbxo34 C A 14: 47,529,454 N90K probably benign Het
Flnc A G 6: 29,447,525 E1109G probably damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gabpb2 A G 3: 95,190,636 V242A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm14409 T C 2: 177,265,430 T92A possibly damaging Het
Gm21798 A T 15: 64,817,883 probably benign Het
Gm765 A T 6: 98,238,119 M181K probably damaging Het
Gpr179 A T 11: 97,346,661 S345T possibly damaging Het
Gusb A T 5: 129,998,118 F377L probably damaging Het
Hnrnpu T C 1: 178,329,373 probably benign Het
Htr3b C T 9: 48,937,048 probably null Het
Iqub A T 6: 24,501,369 V194D probably damaging Het
Itga2b A G 11: 102,461,159 V504A probably benign Het
Itga4 T A 2: 79,288,248 F430L probably damaging Het
Jcad C A 18: 4,673,762 P508H probably damaging Het
Jph1 T C 1: 17,091,611 T276A probably damaging Het
Kansl2 A G 15: 98,531,890 F87S possibly damaging Het
Kdm1b T C 13: 47,063,144 probably null Het
Kif5b C T 18: 6,220,930 D393N probably benign Het
Kmt2d A T 15: 98,849,539 probably benign Het
Krt75 A G 15: 101,570,239 I320T probably damaging Het
Lipo5 T C 19: 33,465,948 N156S unknown Het
Mblac2 A C 13: 81,711,587 Q19P probably null Het
Mfsd4b3 T C 10: 39,948,060 H68R probably damaging Het
Mzb1 A T 18: 35,647,953 probably null Het
Nup210l T A 3: 90,170,030 I891N probably benign Het
Nwd1 G A 8: 72,672,213 R667Q probably damaging Het
Oas1h C T 5: 120,867,109 Q207* probably null Het
Olfr159 A T 4: 43,770,476 F178L possibly damaging Het
Pcdh15 C T 10: 74,504,793 R1120* probably null Het
Pfkl A G 10: 77,988,310 L748P probably damaging Het
Phldb2 T A 16: 45,751,395 K473N probably damaging Het
Rapgef6 G A 11: 54,552,836 V82I probably damaging Het
Rfc3 A T 5: 151,647,495 L112Q probably damaging Het
Rsph6a T A 7: 19,068,072 C349S possibly damaging Het
Sec16a A T 2: 26,441,967 probably benign Het
Sept14 T A 5: 129,692,966 Y222F probably benign Het
Skor2 T C 18: 76,860,295 S571P possibly damaging Het
Slc13a5 T A 11: 72,257,418 M264L probably damaging Het
Slc45a3 T A 1: 131,981,577 V504E probably damaging Het
Smg1 C T 7: 118,152,408 probably benign Het
Smim20 A G 5: 53,277,161 N45S probably null Het
Spp2 A T 1: 88,412,269 S111C probably damaging Het
Sspo A G 6: 48,465,730 probably null Het
Sycp2 C T 2: 178,403,657 probably null Het
Tas2r113 A G 6: 132,893,558 N183S possibly damaging Het
Tcaf2 A T 6: 42,629,745 M425K probably benign Het
Tdrp A G 8: 13,953,845 V164A possibly damaging Het
Tmbim1 A G 1: 74,289,409 F298S probably damaging Het
Tmem211 T A 5: 113,238,170 M161K probably benign Het
Tmem89 A G 9: 108,914,761 probably benign Het
Trpm2 G T 10: 77,932,189 C825* probably null Het
Tsc1 A G 2: 28,675,189 E421G possibly damaging Het
Usp24 T C 4: 106,388,637 I1364T probably benign Het
Vmn1r52 G A 6: 90,178,948 G78E possibly damaging Het
Vmn2r73 T G 7: 85,857,621 I828L probably damaging Het
Vwa5b1 A T 4: 138,610,747 D87E probably benign Het
Zfp451 A T 1: 33,805,384 D47E probably damaging Het
Zfp821 A G 8: 109,724,209 E278G probably damaging Het
Zfp930 A T 8: 69,228,945 T430S probably benign Het
Zfp994 G T 17: 22,200,467 Y500* probably null Het
Zmat3 A T 3: 32,343,687 I142N probably damaging Het
Zzef1 T A 11: 72,901,388 I2266N probably damaging Het
Other mutations in Arrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Arrb2 APN 11 70436871 missense probably damaging 0.99
IGL02484:Arrb2 APN 11 70439474 missense probably damaging 0.99
IGL02550:Arrb2 APN 11 70436870 missense probably damaging 0.96
IGL03375:Arrb2 APN 11 70436179 missense probably damaging 1.00
FR4340:Arrb2 UTSW 11 70438671 missense probably damaging 1.00
FR4342:Arrb2 UTSW 11 70438671 missense probably damaging 1.00
FR4589:Arrb2 UTSW 11 70438671 missense probably damaging 1.00
R1663:Arrb2 UTSW 11 70437603 missense probably damaging 1.00
R1903:Arrb2 UTSW 11 70437982 missense probably damaging 1.00
R5389:Arrb2 UTSW 11 70438658 missense probably damaging 0.97
R6498:Arrb2 UTSW 11 70439549 missense probably benign 0.00
R6800:Arrb2 UTSW 11 70437316 nonsense probably null
R7432:Arrb2 UTSW 11 70437970 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCGTCCTAATGCACCCCAAG -3'
(R):5'- CCTAGAGTCAAGCACTTAAGCG -3'

Sequencing Primer
(F):5'- TGACCACATCACCCTTCCCAG -3'
(R):5'- GTCAAGCACTTAAGCGGTAAAAGACC -3'
Posted On2016-04-15