Incidental Mutation 'R4906:Sycp2'
ID378166
Institutional Source Beutler Lab
Gene Symbol Sycp2
Ensembl Gene ENSMUSG00000060445
Gene Namesynaptonemal complex protein 2
Synonyms3830402K23Rik, 4930518F03Rik
MMRRC Submission 042508-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4906 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location178345293-178407685 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 178403657 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081134] [ENSMUST00000138175]
Predicted Effect probably null
Transcript: ENSMUST00000081134
SMART Domains Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445

DomainStartEndE-ValueType
low complexity region 945 960 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1076 1091 N/A INTRINSIC
low complexity region 1195 1204 N/A INTRINSIC
low complexity region 1273 1293 N/A INTRINSIC
low complexity region 1355 1364 N/A INTRINSIC
coiled coil region 1387 1429 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000138175
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptonemal complex is a proteinaceous structure that links homologous chromosomes during the prophase of meiosis. The protein encoded by this gene is a major component of the synaptonemal complex and may bind DNA at scaffold attachment regions. The encoded protein requires synaptonemal complex protein 3, but not 1, for inclusion in the synaptonemal complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele are sterile due to lack of axial element formation and subsequent failure of chromosome synapsis in prophase I spermatocytes, while females are subfertile with a sharply reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T C 7: 107,624,690 probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adgrf2 T C 17: 42,711,193 I247V probably benign Het
Adgrv1 A G 13: 81,270,738 probably null Het
Ankrd22 T A 19: 34,149,352 K26I possibly damaging Het
Arhgap32 T A 9: 32,245,256 probably null Het
Armc10 A G 5: 21,661,524 Y262C probably damaging Het
Arrb2 A G 11: 70,439,899 D374G probably benign Het
Ascc3 C T 10: 50,749,131 R1675C probably damaging Het
Atg5 T C 10: 44,363,050 *276R probably null Het
Bcl11b G A 12: 107,916,709 T377M probably damaging Het
C1s2 C A 6: 124,635,114 E104* probably null Het
Carf A T 1: 60,141,367 H316L probably damaging Het
Ccdc77 A T 6: 120,334,835 I234N probably damaging Het
Cd300c2 A T 11: 114,997,000 V192E possibly damaging Het
Cep72 G A 13: 74,059,465 R62C probably damaging Het
Clasp1 T A 1: 118,508,910 L308* probably null Het
Clec2g A G 6: 128,979,448 S25G probably benign Het
Cngb1 T C 8: 95,251,973 M1046V probably damaging Het
Cobll1 A T 2: 65,097,693 D1095E probably benign Het
Cpeb2 A G 5: 43,244,662 H662R possibly damaging Het
Cps1 A T 1: 67,139,763 T45S probably benign Het
Cspp1 A G 1: 10,082,328 Q368R possibly damaging Het
Dcaf6 C A 1: 165,411,463 probably null Het
Dcst1 T C 3: 89,350,507 Y652C possibly damaging Het
Elf5 T G 2: 103,449,573 Y225* probably null Het
Ermap A C 4: 119,188,818 probably benign Het
Fam186b A T 15: 99,271,321 V915D probably damaging Het
Fbxo34 C A 14: 47,529,454 N90K probably benign Het
Flnc A G 6: 29,447,525 E1109G probably damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gabpb2 A G 3: 95,190,636 V242A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm14409 T C 2: 177,265,430 T92A possibly damaging Het
Gm21798 A T 15: 64,817,883 probably benign Het
Gm765 A T 6: 98,238,119 M181K probably damaging Het
Gpr179 A T 11: 97,346,661 S345T possibly damaging Het
Gusb A T 5: 129,998,118 F377L probably damaging Het
Hnrnpu T C 1: 178,329,373 probably benign Het
Htr3b C T 9: 48,937,048 probably null Het
Iqub A T 6: 24,501,369 V194D probably damaging Het
Itga2b A G 11: 102,461,159 V504A probably benign Het
Itga4 T A 2: 79,288,248 F430L probably damaging Het
Jcad C A 18: 4,673,762 P508H probably damaging Het
Jph1 T C 1: 17,091,611 T276A probably damaging Het
Kansl2 A G 15: 98,531,890 F87S possibly damaging Het
Kdm1b T C 13: 47,063,144 probably null Het
Kif5b C T 18: 6,220,930 D393N probably benign Het
Kmt2d A T 15: 98,849,539 probably benign Het
Krt75 A G 15: 101,570,239 I320T probably damaging Het
Lipo5 T C 19: 33,465,948 N156S unknown Het
Mblac2 A C 13: 81,711,587 Q19P probably null Het
Mfsd4b3 T C 10: 39,948,060 H68R probably damaging Het
Mzb1 A T 18: 35,647,953 probably null Het
Nup210l T A 3: 90,170,030 I891N probably benign Het
Nwd1 G A 8: 72,672,213 R667Q probably damaging Het
Oas1h C T 5: 120,867,109 Q207* probably null Het
Olfr159 A T 4: 43,770,476 F178L possibly damaging Het
Pcdh15 C T 10: 74,504,793 R1120* probably null Het
Pfkl A G 10: 77,988,310 L748P probably damaging Het
Phldb2 T A 16: 45,751,395 K473N probably damaging Het
Rapgef6 G A 11: 54,552,836 V82I probably damaging Het
Rfc3 A T 5: 151,647,495 L112Q probably damaging Het
Rsph6a T A 7: 19,068,072 C349S possibly damaging Het
Sec16a A T 2: 26,441,967 probably benign Het
Sept14 T A 5: 129,692,966 Y222F probably benign Het
Skor2 T C 18: 76,860,295 S571P possibly damaging Het
Slc13a5 T A 11: 72,257,418 M264L probably damaging Het
Slc45a3 T A 1: 131,981,577 V504E probably damaging Het
Smg1 C T 7: 118,152,408 probably benign Het
Smim20 A G 5: 53,277,161 N45S probably null Het
Spp2 A T 1: 88,412,269 S111C probably damaging Het
Sspo A G 6: 48,465,730 probably null Het
Tas2r113 A G 6: 132,893,558 N183S possibly damaging Het
Tcaf2 A T 6: 42,629,745 M425K probably benign Het
Tdrp A G 8: 13,953,845 V164A possibly damaging Het
Tmbim1 A G 1: 74,289,409 F298S probably damaging Het
Tmem211 T A 5: 113,238,170 M161K probably benign Het
Tmem89 A G 9: 108,914,761 probably benign Het
Trpm2 G T 10: 77,932,189 C825* probably null Het
Tsc1 A G 2: 28,675,189 E421G possibly damaging Het
Usp24 T C 4: 106,388,637 I1364T probably benign Het
Vmn1r52 G A 6: 90,178,948 G78E possibly damaging Het
Vmn2r73 T G 7: 85,857,621 I828L probably damaging Het
Vwa5b1 A T 4: 138,610,747 D87E probably benign Het
Zfp451 A T 1: 33,805,384 D47E probably damaging Het
Zfp821 A G 8: 109,724,209 E278G probably damaging Het
Zfp930 A T 8: 69,228,945 T430S probably benign Het
Zfp994 G T 17: 22,200,467 Y500* probably null Het
Zmat3 A T 3: 32,343,687 I142N probably damaging Het
Zzef1 T A 11: 72,901,388 I2266N probably damaging Het
Other mutations in Sycp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Sycp2 APN 2 178382348 missense probably damaging 1.00
IGL00578:Sycp2 APN 2 178350822 splice site probably benign
IGL00646:Sycp2 APN 2 178374459 missense probably benign 0.00
IGL01309:Sycp2 APN 2 178358111 missense probably benign 0.15
IGL01464:Sycp2 APN 2 178401632 missense probably damaging 0.96
IGL01539:Sycp2 APN 2 178374695 missense probably damaging 1.00
IGL01670:Sycp2 APN 2 178378050 missense probably benign 0.00
IGL02138:Sycp2 APN 2 178358254 missense probably benign 0.31
IGL02138:Sycp2 APN 2 178401990 nonsense probably null
IGL02630:Sycp2 APN 2 178401919 missense probably damaging 1.00
IGL02673:Sycp2 APN 2 178394211 missense possibly damaging 0.63
IGL02961:Sycp2 APN 2 178380862 missense probably benign 0.01
IGL03084:Sycp2 APN 2 178391791 unclassified probably benign
IGL03123:Sycp2 APN 2 178352479 nonsense probably null
IGL03167:Sycp2 APN 2 178379498 missense probably damaging 0.99
R0043:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0050:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0310:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0363:Sycp2 UTSW 2 178346411 splice site probably benign
R0456:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0597:Sycp2 UTSW 2 178356580 missense possibly damaging 0.54
R0608:Sycp2 UTSW 2 178382404 missense probably damaging 0.98
R1112:Sycp2 UTSW 2 178352536 missense probably benign 0.05
R1127:Sycp2 UTSW 2 178374366 missense possibly damaging 0.72
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1413:Sycp2 UTSW 2 178347797 missense probably benign 0.00
R1557:Sycp2 UTSW 2 178395216 unclassified probably benign
R1562:Sycp2 UTSW 2 178382385 missense probably damaging 1.00
R1585:Sycp2 UTSW 2 178351668 missense possibly damaging 0.50
R1932:Sycp2 UTSW 2 178381957 missense probably damaging 1.00
R1950:Sycp2 UTSW 2 178402800 missense probably benign 0.00
R2001:Sycp2 UTSW 2 178378055 missense probably benign 0.05
R2105:Sycp2 UTSW 2 178350138 splice site probably null
R2382:Sycp2 UTSW 2 178378018 critical splice donor site probably null
R2403:Sycp2 UTSW 2 178403735 nonsense probably null
R2483:Sycp2 UTSW 2 178374595 missense probably damaging 0.98
R3003:Sycp2 UTSW 2 178358123 missense probably benign 0.01
R3418:Sycp2 UTSW 2 178401653 splice site probably benign
R3686:Sycp2 UTSW 2 178374384 missense probably benign 0.16
R4038:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4039:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4272:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R4343:Sycp2 UTSW 2 178380947 missense probably damaging 0.99
R4491:Sycp2 UTSW 2 178374985 missense probably damaging 1.00
R4534:Sycp2 UTSW 2 178355009 missense probably damaging 1.00
R4720:Sycp2 UTSW 2 178374432 missense probably benign 0.11
R4805:Sycp2 UTSW 2 178393961 unclassified probably benign
R4807:Sycp2 UTSW 2 178393961 unclassified probably benign
R4808:Sycp2 UTSW 2 178393961 unclassified probably benign
R4910:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R5282:Sycp2 UTSW 2 178403761 missense probably damaging 1.00
R5285:Sycp2 UTSW 2 178392398 splice site probably null
R5316:Sycp2 UTSW 2 178356503 missense probably benign 0.00
R5389:Sycp2 UTSW 2 178377702 splice site probably null
R5621:Sycp2 UTSW 2 178381918 missense probably benign 0.05
R5652:Sycp2 UTSW 2 178358705 splice site probably null
R5880:Sycp2 UTSW 2 178374470 missense possibly damaging 0.92
R6114:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6115:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6186:Sycp2 UTSW 2 178383560 missense probably damaging 0.97
R6351:Sycp2 UTSW 2 178363416 missense probably damaging 1.00
R6509:Sycp2 UTSW 2 178395894 missense probably damaging 1.00
R6536:Sycp2 UTSW 2 178351648 missense probably damaging 1.00
R6679:Sycp2 UTSW 2 178380928 missense probably damaging 0.96
R6687:Sycp2 UTSW 2 178354960 missense probably damaging 0.99
R6761:Sycp2 UTSW 2 178374351 splice site probably null
R6786:Sycp2 UTSW 2 178383552 missense possibly damaging 0.63
R7357:Sycp2 UTSW 2 178403804 splice site probably null
R7422:Sycp2 UTSW 2 178394151 missense probably damaging 1.00
R7519:Sycp2 UTSW 2 178346333 makesense probably null
R7805:Sycp2 UTSW 2 178380858 missense probably damaging 0.99
R7960:Sycp2 UTSW 2 178404660 missense probably null 0.90
R8022:Sycp2 UTSW 2 178355062 missense probably damaging 1.00
R8037:Sycp2 UTSW 2 178403778 missense probably damaging 1.00
R8038:Sycp2 UTSW 2 178403778 missense probably damaging 1.00
R8039:Sycp2 UTSW 2 178374585 missense probably benign 0.05
R8159:Sycp2 UTSW 2 178354977 missense probably damaging 0.97
R8233:Sycp2 UTSW 2 178356634 missense probably damaging 1.00
R8436:Sycp2 UTSW 2 178362968 missense probably benign 0.44
R8437:Sycp2 UTSW 2 178364858 missense probably damaging 1.00
Z1088:Sycp2 UTSW 2 178374367 missense probably benign
Z1088:Sycp2 UTSW 2 178381934 missense probably benign 0.17
Z1176:Sycp2 UTSW 2 178364881 missense probably damaging 1.00
Z1177:Sycp2 UTSW 2 178380875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAATGTGTTGTGAAGCCTC -3'
(R):5'- AACTCTTCTTTGGTAGCTCAGTTGC -3'

Sequencing Primer
(F):5'- GTTGTGAAGCCTCAAATAATAAGCAC -3'
(R):5'- AGCTCAGTTGCATAGAGTGGC -3'
Posted On2016-04-15