Incidental Mutation 'R4906:Trpm2'
ID 378214
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Name transient receptor potential cation channel, subfamily M, member 2
Synonyms LTRPC2, 9830168K16Rik, TRPC7, Trrp7
MMRRC Submission 042508-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # R4906 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 77907722-77970563 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 77932189 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 825 (C825*)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
AlphaFold Q91YD4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105400
Predicted Effect probably null
Transcript: ENSMUST00000105401
AA Change: C825*
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: C825*

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153842
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T C 7: 107,624,690 (GRCm38) probably benign Het
Ablim2 C T 5: 35,802,422 (GRCm38) R73C possibly damaging Het
Adgrf2 T C 17: 42,711,193 (GRCm38) I247V probably benign Het
Adgrv1 A G 13: 81,270,738 (GRCm38) probably null Het
Ankrd22 T A 19: 34,149,352 (GRCm38) K26I possibly damaging Het
Arhgap32 T A 9: 32,245,256 (GRCm38) probably null Het
Armc10 A G 5: 21,661,524 (GRCm38) Y262C probably damaging Het
Arrb2 A G 11: 70,439,899 (GRCm38) D374G probably benign Het
Ascc3 C T 10: 50,749,131 (GRCm38) R1675C probably damaging Het
Atg5 T C 10: 44,363,050 (GRCm38) *276R probably null Het
Bcl11b G A 12: 107,916,709 (GRCm38) T377M probably damaging Het
C1s2 C A 6: 124,635,114 (GRCm38) E104* probably null Het
Carf A T 1: 60,141,367 (GRCm38) H316L probably damaging Het
Ccdc77 A T 6: 120,334,835 (GRCm38) I234N probably damaging Het
Cd300c2 A T 11: 114,997,000 (GRCm38) V192E possibly damaging Het
Cep72 G A 13: 74,059,465 (GRCm38) R62C probably damaging Het
Clasp1 T A 1: 118,508,910 (GRCm38) L308* probably null Het
Clec2g A G 6: 128,979,448 (GRCm38) S25G probably benign Het
Cngb1 T C 8: 95,251,973 (GRCm38) M1046V probably damaging Het
Cobll1 A T 2: 65,097,693 (GRCm38) D1095E probably benign Het
Cpeb2 A G 5: 43,244,662 (GRCm38) H662R possibly damaging Het
Cps1 A T 1: 67,139,763 (GRCm38) T45S probably benign Het
Cspp1 A G 1: 10,082,328 (GRCm38) Q368R possibly damaging Het
Dcaf6 C A 1: 165,411,463 (GRCm38) probably null Het
Dcst1 T C 3: 89,350,507 (GRCm38) Y652C possibly damaging Het
Elf5 T G 2: 103,449,573 (GRCm38) Y225* probably null Het
Ermap A C 4: 119,188,818 (GRCm38) probably benign Het
Fam186b A T 15: 99,271,321 (GRCm38) V915D probably damaging Het
Fbxo34 C A 14: 47,529,454 (GRCm38) N90K probably benign Het
Flnc A G 6: 29,447,525 (GRCm38) E1109G probably damaging Het
Flt1 C A 5: 147,683,939 (GRCm38) A132S probably benign Het
Gabpb2 A G 3: 95,190,636 (GRCm38) V242A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 (GRCm38) probably benign Het
Gm14409 T C 2: 177,265,430 (GRCm38) T92A possibly damaging Het
Gm21798 A T 15: 64,817,883 (GRCm38) probably benign Het
Gm765 A T 6: 98,238,119 (GRCm38) M181K probably damaging Het
Gpr179 A T 11: 97,346,661 (GRCm38) S345T possibly damaging Het
Gusb A T 5: 129,998,118 (GRCm38) F377L probably damaging Het
Hnrnpu T C 1: 178,329,373 (GRCm38) probably benign Het
Htr3b C T 9: 48,937,048 (GRCm38) probably null Het
Iqub A T 6: 24,501,369 (GRCm38) V194D probably damaging Het
Itga2b A G 11: 102,461,159 (GRCm38) V504A probably benign Het
Itga4 T A 2: 79,288,248 (GRCm38) F430L probably damaging Het
Jcad C A 18: 4,673,762 (GRCm38) P508H probably damaging Het
Jph1 T C 1: 17,091,611 (GRCm38) T276A probably damaging Het
Kansl2 A G 15: 98,531,890 (GRCm38) F87S possibly damaging Het
Kdm1b T C 13: 47,063,144 (GRCm38) probably null Het
Kif5b C T 18: 6,220,930 (GRCm38) D393N probably benign Het
Kmt2d A T 15: 98,849,539 (GRCm38) probably benign Het
Krt75 A G 15: 101,570,239 (GRCm38) I320T probably damaging Het
Lipo5 T C 19: 33,465,948 (GRCm38) N156S unknown Het
Mblac2 A C 13: 81,711,587 (GRCm38) Q19P probably null Het
Mfsd4b3 T C 10: 39,948,060 (GRCm38) H68R probably damaging Het
Mzb1 A T 18: 35,647,953 (GRCm38) probably null Het
Nup210l T A 3: 90,170,030 (GRCm38) I891N probably benign Het
Nwd1 G A 8: 72,672,213 (GRCm38) R667Q probably damaging Het
Oas1h C T 5: 120,867,109 (GRCm38) Q207* probably null Het
Olfr159 A T 4: 43,770,476 (GRCm38) F178L possibly damaging Het
Pcdh15 C T 10: 74,504,793 (GRCm38) R1120* probably null Het
Pfkl A G 10: 77,988,310 (GRCm38) L748P probably damaging Het
Phldb2 T A 16: 45,751,395 (GRCm38) K473N probably damaging Het
Rapgef6 G A 11: 54,552,836 (GRCm38) V82I probably damaging Het
Rfc3 A T 5: 151,647,495 (GRCm38) L112Q probably damaging Het
Rsph6a T A 7: 19,068,072 (GRCm38) C349S possibly damaging Het
Sec16a A T 2: 26,441,967 (GRCm38) probably benign Het
Sept14 T A 5: 129,692,966 (GRCm38) Y222F probably benign Het
Skor2 T C 18: 76,860,295 (GRCm38) S571P possibly damaging Het
Slc13a5 T A 11: 72,257,418 (GRCm38) M264L probably damaging Het
Slc45a3 T A 1: 131,981,577 (GRCm38) V504E probably damaging Het
Smg1 C T 7: 118,152,408 (GRCm38) probably benign Het
Smim20 A G 5: 53,277,161 (GRCm38) N45S probably null Het
Spp2 A T 1: 88,412,269 (GRCm38) S111C probably damaging Het
Sspo A G 6: 48,465,730 (GRCm38) probably null Het
Sycp2 C T 2: 178,403,657 (GRCm38) probably null Het
Tas2r113 A G 6: 132,893,558 (GRCm38) N183S possibly damaging Het
Tcaf2 A T 6: 42,629,745 (GRCm38) M425K probably benign Het
Tdrp A G 8: 13,953,845 (GRCm38) V164A possibly damaging Het
Tmbim1 A G 1: 74,289,409 (GRCm38) F298S probably damaging Het
Tmem211 T A 5: 113,238,170 (GRCm38) M161K probably benign Het
Tmem89 A G 9: 108,914,761 (GRCm38) probably benign Het
Tsc1 A G 2: 28,675,189 (GRCm38) E421G possibly damaging Het
Usp24 T C 4: 106,388,637 (GRCm38) I1364T probably benign Het
Vmn1r52 G A 6: 90,178,948 (GRCm38) G78E possibly damaging Het
Vmn2r73 T G 7: 85,857,621 (GRCm38) I828L probably damaging Het
Vwa5b1 A T 4: 138,610,747 (GRCm38) D87E probably benign Het
Zfp451 A T 1: 33,805,384 (GRCm38) D47E probably damaging Het
Zfp821 A G 8: 109,724,209 (GRCm38) E278G probably damaging Het
Zfp930 A T 8: 69,228,945 (GRCm38) T430S probably benign Het
Zfp994 G T 17: 22,200,467 (GRCm38) Y500* probably null Het
Zmat3 A T 3: 32,343,687 (GRCm38) I142N probably damaging Het
Zzef1 T A 11: 72,901,388 (GRCm38) I2266N probably damaging Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77,942,915 (GRCm38) splice site probably null
IGL00773:Trpm2 APN 10 77,949,214 (GRCm38) nonsense probably null
IGL00962:Trpm2 APN 10 77,943,916 (GRCm38) splice site probably benign
IGL01093:Trpm2 APN 10 77,932,280 (GRCm38) missense probably benign 0.04
IGL01124:Trpm2 APN 10 77,945,825 (GRCm38) splice site probably benign
IGL01301:Trpm2 APN 10 77,923,984 (GRCm38) missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77,942,996 (GRCm38) nonsense probably null
IGL02175:Trpm2 APN 10 77,937,907 (GRCm38) missense probably benign 0.07
IGL02653:Trpm2 APN 10 77,912,669 (GRCm38) missense probably benign 0.19
IGL02667:Trpm2 APN 10 77,935,942 (GRCm38) missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77,935,942 (GRCm38) missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77,918,986 (GRCm38) missense probably benign 0.16
IGL02951:Trpm2 APN 10 77,929,278 (GRCm38) missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77,918,909 (GRCm38) missense probably benign 0.18
IGL03242:Trpm2 APN 10 77,917,734 (GRCm38) missense probably benign
IGL03405:Trpm2 APN 10 77,966,072 (GRCm38) splice site probably benign
Fugit UTSW 10 77,938,368 (GRCm38) missense probably damaging 1.00
scusate UTSW 10 77,966,994 (GRCm38) nonsense probably null
temporal UTSW 10 77,925,682 (GRCm38) missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77,923,984 (GRCm38) missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77,925,825 (GRCm38) missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77,925,825 (GRCm38) missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77,943,990 (GRCm38) splice site probably benign
R0332:Trpm2 UTSW 10 77,947,988 (GRCm38) missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77,923,516 (GRCm38) missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77,929,288 (GRCm38) missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77,923,564 (GRCm38) missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77,966,007 (GRCm38) missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77,966,994 (GRCm38) nonsense probably null
R1518:Trpm2 UTSW 10 77,943,005 (GRCm38) missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77,942,999 (GRCm38) missense probably benign 0.14
R1593:Trpm2 UTSW 10 77,943,076 (GRCm38) missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77,935,875 (GRCm38) splice site probably null
R1673:Trpm2 UTSW 10 77,942,944 (GRCm38) missense probably benign
R1912:Trpm2 UTSW 10 77,945,876 (GRCm38) missense probably benign 0.10
R1932:Trpm2 UTSW 10 77,941,158 (GRCm38) missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77,947,989 (GRCm38) missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77,925,766 (GRCm38) missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77,932,179 (GRCm38) missense probably benign 0.01
R2201:Trpm2 UTSW 10 77,920,471 (GRCm38) nonsense probably null
R2217:Trpm2 UTSW 10 77,941,182 (GRCm38) missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77,918,964 (GRCm38) missense probably benign 0.04
R2339:Trpm2 UTSW 10 77,914,806 (GRCm38) splice site probably benign
R2395:Trpm2 UTSW 10 77,947,880 (GRCm38) missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77,930,637 (GRCm38) missense probably benign 0.14
R2405:Trpm2 UTSW 10 77,934,724 (GRCm38) missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77,941,174 (GRCm38) missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77,930,534 (GRCm38) critical splice donor site probably null
R3002:Trpm2 UTSW 10 77,930,534 (GRCm38) critical splice donor site probably null
R3125:Trpm2 UTSW 10 77,911,374 (GRCm38) missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77,932,302 (GRCm38) missense probably benign 0.03
R3777:Trpm2 UTSW 10 77,935,990 (GRCm38) missense probably benign 0.13
R3778:Trpm2 UTSW 10 77,935,990 (GRCm38) missense probably benign 0.13
R4272:Trpm2 UTSW 10 77,933,642 (GRCm38) missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77,917,725 (GRCm38) missense probably benign 0.44
R4395:Trpm2 UTSW 10 77,929,219 (GRCm38) missense probably benign 0.01
R4423:Trpm2 UTSW 10 77,935,068 (GRCm38) missense probably benign 0.00
R4452:Trpm2 UTSW 10 77,923,593 (GRCm38) missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77,945,916 (GRCm38) missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77,938,138 (GRCm38) missense probably benign 0.05
R4825:Trpm2 UTSW 10 77,941,173 (GRCm38) missense probably damaging 0.98
R4943:Trpm2 UTSW 10 77,966,007 (GRCm38) missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77,917,792 (GRCm38) missense probably benign 0.34
R5046:Trpm2 UTSW 10 77,966,018 (GRCm38) missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77,923,521 (GRCm38) missense probably benign 0.06
R5523:Trpm2 UTSW 10 77,935,961 (GRCm38) missense probably benign 0.04
R5562:Trpm2 UTSW 10 77,959,939 (GRCm38) missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77,932,139 (GRCm38) missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77,912,636 (GRCm38) missense probably benign 0.00
R5633:Trpm2 UTSW 10 77,938,353 (GRCm38) missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77,965,980 (GRCm38) missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77,959,900 (GRCm38) missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77,917,713 (GRCm38) missense probably benign 0.00
R6075:Trpm2 UTSW 10 77,935,043 (GRCm38) critical splice donor site probably null
R6092:Trpm2 UTSW 10 77,925,682 (GRCm38) missense probably benign 0.30
R6309:Trpm2 UTSW 10 77,938,368 (GRCm38) missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77,932,227 (GRCm38) missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77,937,826 (GRCm38) missense probably benign 0.01
R6579:Trpm2 UTSW 10 77,937,826 (GRCm38) missense probably benign 0.01
R6640:Trpm2 UTSW 10 77,937,826 (GRCm38) missense probably benign 0.01
R6642:Trpm2 UTSW 10 77,937,826 (GRCm38) missense probably benign 0.01
R6798:Trpm2 UTSW 10 77,914,740 (GRCm38) missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77,935,891 (GRCm38) missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77,912,592 (GRCm38) missense probably benign
R7036:Trpm2 UTSW 10 77,912,592 (GRCm38) missense probably benign
R7113:Trpm2 UTSW 10 77,947,931 (GRCm38) missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77,924,014 (GRCm38) missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77,935,876 (GRCm38) critical splice donor site probably null
R7274:Trpm2 UTSW 10 77,923,555 (GRCm38) missense probably benign 0.00
R7379:Trpm2 UTSW 10 77,914,734 (GRCm38) missense probably benign
R7527:Trpm2 UTSW 10 77,966,060 (GRCm38) missense probably benign 0.01
R7571:Trpm2 UTSW 10 77,937,950 (GRCm38) missense probably benign 0.21
R7600:Trpm2 UTSW 10 77,938,051 (GRCm38) missense probably benign 0.02
R7727:Trpm2 UTSW 10 77,925,789 (GRCm38) missense probably benign 0.34
R7771:Trpm2 UTSW 10 77,932,179 (GRCm38) missense probably benign 0.01
R7844:Trpm2 UTSW 10 77,923,506 (GRCm38) missense probably benign 0.00
R8158:Trpm2 UTSW 10 77,947,897 (GRCm38) missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77,947,973 (GRCm38) missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77,947,973 (GRCm38) missense probably damaging 1.00
R8239:Trpm2 UTSW 10 77,936,002 (GRCm38) missense probably benign 0.06
R8275:Trpm2 UTSW 10 77,966,025 (GRCm38) nonsense probably null
R8340:Trpm2 UTSW 10 77,923,624 (GRCm38) nonsense probably null
R8354:Trpm2 UTSW 10 77,933,649 (GRCm38) missense probably damaging 1.00
R8427:Trpm2 UTSW 10 77,911,402 (GRCm38) missense possibly damaging 0.93
R8445:Trpm2 UTSW 10 77,910,252 (GRCm38) missense probably damaging 1.00
R8769:Trpm2 UTSW 10 77,932,294 (GRCm38) missense probably benign 0.00
R9144:Trpm2 UTSW 10 77,929,288 (GRCm38) missense probably benign 0.01
R9286:Trpm2 UTSW 10 77,941,180 (GRCm38) missense probably benign 0.06
R9319:Trpm2 UTSW 10 77,949,198 (GRCm38) missense probably damaging 1.00
R9319:Trpm2 UTSW 10 77,942,942 (GRCm38) nonsense probably null
R9381:Trpm2 UTSW 10 77,911,357 (GRCm38) missense possibly damaging 0.90
R9457:Trpm2 UTSW 10 77,911,392 (GRCm38) missense possibly damaging 0.82
R9477:Trpm2 UTSW 10 77,911,390 (GRCm38) missense probably benign 0.12
R9547:Trpm2 UTSW 10 77,912,633 (GRCm38) missense probably benign 0.33
R9660:Trpm2 UTSW 10 77,930,555 (GRCm38) missense probably benign 0.00
R9663:Trpm2 UTSW 10 77,920,486 (GRCm38) missense probably benign 0.01
Z1177:Trpm2 UTSW 10 77,937,868 (GRCm38) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACCGGAATCTGAGGTCAATCATG -3'
(R):5'- CTTCTGCAGGGAAAAGAGGC -3'

Sequencing Primer
(F):5'- CCTTGGAAAGGCCCAGAAGC -3'
(R):5'- AAAGAGGCTGCAGGCAC -3'
Posted On 2016-04-15