Incidental Mutation 'R4907:Vmn2r54'
ID379107
Institutional Source Beutler Lab
Gene Symbol Vmn2r54
Ensembl Gene ENSMUSG00000096593
Gene Namevomeronasal 2, receptor 54
SynonymsEG666085, Gm470, LOC232871, LOC385080
MMRRC Submission 042509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R4907 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12615233-12636134 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 12616223 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086210]
Predicted Effect probably null
Transcript: ENSMUST00000086210
SMART Domains Protein: ENSMUSP00000083386
Gene: ENSMUSG00000096593

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 4.3e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 1.2e-54 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 98% (89/91)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik G T 1: 57,383,191 G242V probably damaging Het
4933412E24Rik T C 15: 60,016,108 E161G probably benign Het
Abcc5 A G 16: 20,376,546 S734P possibly damaging Het
Actn1 T G 12: 80,181,414 H394P probably damaging Het
Adam8 A T 7: 139,989,373 D144E probably benign Het
Ankrd50 T A 3: 38,454,973 K1082* probably null Het
Ankrd50 A T 3: 38,456,675 N514K probably damaging Het
Atp4a A G 7: 30,719,092 I602V possibly damaging Het
Baz2a A G 10: 128,110,808 T64A probably damaging Het
Btbd19 A G 4: 117,120,567 probably benign Het
Casz1 T A 4: 148,944,541 S1148T probably damaging Het
Ccdc18 T A 5: 108,136,141 D103E probably benign Het
Cd209d T C 8: 3,877,948 N52S probably benign Het
Cdh7 T A 1: 110,138,323 Y776N probably damaging Het
Cdk14 A G 5: 5,249,140 V101A probably damaging Het
Cldn22 T C 8: 47,824,707 V60A probably benign Het
Clec10a G A 11: 70,169,971 G183D probably benign Het
Cnga3 T C 1: 37,241,942 probably null Het
Cts3 A T 13: 61,566,820 F224I probably benign Het
Fbxo40 A G 16: 36,969,702 Y349H probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gm10029 A T 13: 6,662,556 noncoding transcript Het
Gm14399 T A 2: 175,131,389 probably benign Het
Gm9932 T C 5: 100,199,155 noncoding transcript Het
Immp1l A G 2: 105,937,117 Y107C probably damaging Het
Ism1 G T 2: 139,678,752 G28V probably benign Het
Klf1 C A 8: 84,903,185 S213* probably null Het
Krt12 T C 11: 99,418,362 E329G probably damaging Het
Lama2 A T 10: 27,164,946 N1460K probably benign Het
Llgl2 T A 11: 115,853,974 Y932* probably null Het
Lrrc7 T C 3: 158,161,240 I955V probably damaging Het
Ltbp1 A G 17: 75,005,904 R7G probably benign Het
Mcm3ap A G 10: 76,493,441 E1152G probably damaging Het
Mgam2-ps T C 6: 40,834,743 noncoding transcript Het
Mical3 T A 6: 121,007,298 M206L probably benign Het
Mndal T G 1: 173,862,690 N358T probably damaging Het
Nckap5 A G 1: 126,026,152 S824P possibly damaging Het
Ndufb2 T C 6: 39,596,620 probably benign Het
Nfatc3 C A 8: 106,079,727 H401Q probably damaging Het
Npas2 T C 1: 39,361,985 V810A unknown Het
Nt5c2 A G 19: 46,896,539 V245A possibly damaging Het
Olfr1463 A G 19: 13,234,793 D181G probably damaging Het
Olfr350 A T 2: 36,850,258 I71F probably benign Het
Olfr615 A G 7: 103,561,034 M186V possibly damaging Het
Olfr651 A G 7: 104,553,311 R131G probably damaging Het
Olfr984 A T 9: 40,100,659 M277K probably benign Het
Otof A T 5: 30,378,661 probably null Het
Pck1 C T 2: 173,157,023 T358I probably damaging Het
Pclo T C 5: 14,680,051 probably benign Het
Pgm1 T A 5: 64,103,878 F238L probably benign Het
Pgr G A 9: 8,947,043 probably benign Het
Pkd1l3 T A 8: 109,640,843 V1224E probably damaging Het
Pkd2l1 A G 19: 44,154,142 V487A possibly damaging Het
Pkhd1 T C 1: 20,209,226 D2956G probably damaging Het
Rexo2 A T 9: 48,479,403 probably null Het
Rgs22 T A 15: 36,087,424 L573F possibly damaging Het
Rufy3 T G 5: 88,584,192 I18S possibly damaging Het
Slc30a9 T C 5: 67,346,162 L393P probably damaging Het
Snw1 T C 12: 87,459,489 I214V probably benign Het
Sorbs1 G A 19: 40,340,047 Q595* probably null Het
Spata21 T A 4: 141,097,121 probably null Het
Ss18l1 G T 2: 180,063,399 probably null Het
Tmem163 A T 1: 127,519,370 L176H probably damaging Het
Tpd52 T C 3: 8,944,608 probably null Het
Tpsab1 T A 17: 25,343,462 Y297F possibly damaging Het
Trim55 A G 3: 19,674,374 T450A probably benign Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Txndc11 A T 16: 11,088,534 H377Q probably benign Het
Usp17la A G 7: 104,861,148 Y320C probably damaging Het
Vmn2r109 T C 17: 20,550,086 N547D probably damaging Het
Wdr33 T C 18: 31,906,993 *1331Q probably null Het
Wdr34 A G 2: 30,032,460 probably null Het
Wdr90 T A 17: 25,860,650 probably benign Het
Xpo7 T C 14: 70,670,629 M903V probably benign Het
Zfhx3 T A 8: 108,793,354 S369R probably damaging Het
Zfp808 T C 13: 62,171,473 F172S possibly damaging Het
Zfp821 A G 8: 109,723,993 E55G probably benign Het
Zfp964 T C 8: 69,663,322 Y191H possibly damaging Het
Zfyve1 T C 12: 83,574,872 T250A probably damaging Het
Other mutations in Vmn2r54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Vmn2r54 APN 7 12631913 splice site probably benign
IGL01778:Vmn2r54 APN 7 12632082 missense probably benign 0.07
IGL01998:Vmn2r54 APN 7 12615300 missense probably benign
IGL02028:Vmn2r54 APN 7 12632161 missense probably damaging 1.00
IGL02064:Vmn2r54 APN 7 12615606 missense probably benign 0.02
IGL02238:Vmn2r54 APN 7 12635983 missense probably damaging 1.00
IGL03062:Vmn2r54 APN 7 12632428 missense probably damaging 0.98
IGL03120:Vmn2r54 APN 7 12615387 missense probably damaging 1.00
PIT4453001:Vmn2r54 UTSW 7 12629742 missense probably benign 0.06
R0212:Vmn2r54 UTSW 7 12632497 missense probably benign
R0360:Vmn2r54 UTSW 7 12615649 missense probably damaging 1.00
R1646:Vmn2r54 UTSW 7 12632507 missense probably damaging 1.00
R1673:Vmn2r54 UTSW 7 12616211 critical splice acceptor site probably null
R1738:Vmn2r54 UTSW 7 12635888 missense probably benign 0.00
R1856:Vmn2r54 UTSW 7 12632311 missense probably benign
R2012:Vmn2r54 UTSW 7 12615877 missense probably damaging 1.00
R2038:Vmn2r54 UTSW 7 12629710 missense possibly damaging 0.94
R2160:Vmn2r54 UTSW 7 12615493 missense probably benign 0.29
R2397:Vmn2r54 UTSW 7 12615651 missense probably damaging 0.98
R2430:Vmn2r54 UTSW 7 12632006 missense probably damaging 0.99
R2829:Vmn2r54 UTSW 7 12615690 missense possibly damaging 0.62
R2975:Vmn2r54 UTSW 7 12635992 missense possibly damaging 0.92
R3005:Vmn2r54 UTSW 7 12615294 missense probably benign 0.28
R3725:Vmn2r54 UTSW 7 12632296 missense probably benign 0.42
R4486:Vmn2r54 UTSW 7 12632272 nonsense probably null
R4881:Vmn2r54 UTSW 7 12629671 missense probably benign 0.00
R5536:Vmn2r54 UTSW 7 12632416 missense probably benign 0.03
R5637:Vmn2r54 UTSW 7 12615369 missense probably benign 0.41
R5703:Vmn2r54 UTSW 7 12629667 missense probably benign 0.22
R5769:Vmn2r54 UTSW 7 12615282 missense possibly damaging 0.73
R5972:Vmn2r54 UTSW 7 12615352 missense probably damaging 1.00
R5972:Vmn2r54 UTSW 7 12635947 missense probably damaging 1.00
R5977:Vmn2r54 UTSW 7 12632216 missense probably damaging 1.00
R6084:Vmn2r54 UTSW 7 12632278 missense probably damaging 0.98
R6176:Vmn2r54 UTSW 7 12615981 missense probably damaging 1.00
R6229:Vmn2r54 UTSW 7 12631956 missense probably benign 0.00
R6371:Vmn2r54 UTSW 7 12615435 missense probably damaging 1.00
R6374:Vmn2r54 UTSW 7 12615493 missense probably damaging 1.00
R6804:Vmn2r54 UTSW 7 12629865 missense probably benign
R6886:Vmn2r54 UTSW 7 12632153 missense probably benign 0.02
R7041:Vmn2r54 UTSW 7 12629824 missense probably damaging 0.99
R7058:Vmn2r54 UTSW 7 12615795 missense possibly damaging 0.70
R7113:Vmn2r54 UTSW 7 12616074 missense probably damaging 1.00
R7124:Vmn2r54 UTSW 7 12622151 missense probably benign 0.00
R7126:Vmn2r54 UTSW 7 12632161 missense possibly damaging 0.91
R7236:Vmn2r54 UTSW 7 12631990 missense possibly damaging 0.84
R7337:Vmn2r54 UTSW 7 12622117 missense probably benign 0.00
R7406:Vmn2r54 UTSW 7 12616223 splice site probably null
R7634:Vmn2r54 UTSW 7 12615703 missense probably damaging 1.00
R7793:Vmn2r54 UTSW 7 12632269 missense probably damaging 0.98
R8139:Vmn2r54 UTSW 7 12615816 missense possibly damaging 0.92
R8158:Vmn2r54 UTSW 7 12615961 missense probably damaging 1.00
R8179:Vmn2r54 UTSW 7 12632091 nonsense probably null
R8440:Vmn2r54 UTSW 7 12616086 missense possibly damaging 0.72
U24488:Vmn2r54 UTSW 7 12615429 missense possibly damaging 0.84
X0066:Vmn2r54 UTSW 7 12615370 missense probably damaging 1.00
Z1177:Vmn2r54 UTSW 7 12632108 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCTTCAGGAACACTCCAAG -3'
(R):5'- GCCAGGTTGTGTTACAGTACAC -3'

Sequencing Primer
(F):5'- TTCAGGAACACTCCAAGAACCAGG -3'
(R):5'- TGTTACAGTACACACTTTTAAGACAG -3'
Posted On2016-04-15