Incidental Mutation 'R4907:Flt1'
ID439427
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene NameFMS-like tyrosine kinase 1
SynonymsFlt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1
MMRRC Submission 042509-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4907 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location147561604-147726011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 147683939 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 132 (A132S)
Ref Sequence ENSEMBL: ENSMUSP00000106158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653] [ENSMUST00000110529]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031652
SMART Domains Protein: ENSMUSP00000031652
Gene: ENSMUSG00000029648

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
Pfam:Ig_2 434 511 9.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031653
AA Change: A132S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: A132S

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110529
AA Change: A132S

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106158
Gene: ENSMUSG00000029648
AA Change: A132S

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik G T 1: 57,383,191 G242V probably damaging Het
4933412E24Rik T C 15: 60,016,108 E161G probably benign Het
Abcc5 A G 16: 20,376,546 S734P possibly damaging Het
Actn1 T G 12: 80,181,414 H394P probably damaging Het
Adam8 A T 7: 139,989,373 D144E probably benign Het
Ankrd50 T A 3: 38,454,973 K1082* probably null Het
Ankrd50 A T 3: 38,456,675 N514K probably damaging Het
Atp4a A G 7: 30,719,092 I602V possibly damaging Het
Baz2a A G 10: 128,110,808 T64A probably damaging Het
Btbd19 A G 4: 117,120,567 probably benign Het
Casz1 T A 4: 148,944,541 S1148T probably damaging Het
Ccdc18 T A 5: 108,136,141 D103E probably benign Het
Cd209d T C 8: 3,877,948 N52S probably benign Het
Cdh7 T A 1: 110,138,323 Y776N probably damaging Het
Cdk14 A G 5: 5,249,140 V101A probably damaging Het
Cldn22 T C 8: 47,824,707 V60A probably benign Het
Clec10a G A 11: 70,169,971 G183D probably benign Het
Cnga3 T C 1: 37,241,942 probably null Het
Cts3 A T 13: 61,566,820 F224I probably benign Het
Fbxo40 A G 16: 36,969,702 Y349H probably benign Het
Gm10029 A T 13: 6,662,556 noncoding transcript Het
Gm14399 T A 2: 175,131,389 probably benign Het
Gm9932 T C 5: 100,199,155 noncoding transcript Het
Immp1l A G 2: 105,937,117 Y107C probably damaging Het
Ism1 G T 2: 139,678,752 G28V probably benign Het
Klf1 C A 8: 84,903,185 S213* probably null Het
Krt12 T C 11: 99,418,362 E329G probably damaging Het
Lama2 A T 10: 27,164,946 N1460K probably benign Het
Llgl2 T A 11: 115,853,974 Y932* probably null Het
Lrrc7 T C 3: 158,161,240 I955V probably damaging Het
Ltbp1 A G 17: 75,005,904 R7G probably benign Het
Mcm3ap A G 10: 76,493,441 E1152G probably damaging Het
Mgam2-ps T C 6: 40,834,743 noncoding transcript Het
Mical3 T A 6: 121,007,298 M206L probably benign Het
Mndal T G 1: 173,862,690 N358T probably damaging Het
Nckap5 A G 1: 126,026,152 S824P possibly damaging Het
Ndufb2 T C 6: 39,596,620 probably benign Het
Nfatc3 C A 8: 106,079,727 H401Q probably damaging Het
Npas2 T C 1: 39,361,985 V810A unknown Het
Nt5c2 A G 19: 46,896,539 V245A possibly damaging Het
Olfr1463 A G 19: 13,234,793 D181G probably damaging Het
Olfr350 A T 2: 36,850,258 I71F probably benign Het
Olfr615 A G 7: 103,561,034 M186V possibly damaging Het
Olfr651 A G 7: 104,553,311 R131G probably damaging Het
Olfr984 A T 9: 40,100,659 M277K probably benign Het
Otof A T 5: 30,378,661 probably null Het
Pck1 C T 2: 173,157,023 T358I probably damaging Het
Pclo T C 5: 14,680,051 probably benign Het
Pgm1 T A 5: 64,103,878 F238L probably benign Het
Pgr G A 9: 8,947,043 probably benign Het
Pkd1l3 T A 8: 109,640,843 V1224E probably damaging Het
Pkd2l1 A G 19: 44,154,142 V487A possibly damaging Het
Pkhd1 T C 1: 20,209,226 D2956G probably damaging Het
Rexo2 A T 9: 48,479,403 probably null Het
Rgs22 T A 15: 36,087,424 L573F possibly damaging Het
Rufy3 T G 5: 88,584,192 I18S possibly damaging Het
Slc30a9 T C 5: 67,346,162 L393P probably damaging Het
Snw1 T C 12: 87,459,489 I214V probably benign Het
Sorbs1 G A 19: 40,340,047 Q595* probably null Het
Spata21 T A 4: 141,097,121 probably null Het
Ss18l1 G T 2: 180,063,399 probably null Het
Tmem163 A T 1: 127,519,370 L176H probably damaging Het
Tpd52 T C 3: 8,944,608 probably null Het
Tpsab1 T A 17: 25,343,462 Y297F possibly damaging Het
Trim55 A G 3: 19,674,374 T450A probably benign Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Txndc11 A T 16: 11,088,534 H377Q probably benign Het
Usp17la A G 7: 104,861,148 Y320C probably damaging Het
Vmn2r109 T C 17: 20,550,086 N547D probably damaging Het
Vmn2r54 A T 7: 12,616,223 probably null Het
Wdr33 T C 18: 31,906,993 *1331Q probably null Het
Wdr34 A G 2: 30,032,460 probably null Het
Wdr90 T A 17: 25,860,650 probably benign Het
Xpo7 T C 14: 70,670,629 M903V probably benign Het
Zfhx3 T A 8: 108,793,354 S369R probably damaging Het
Zfp808 T C 13: 62,171,473 F172S possibly damaging Het
Zfp821 A G 8: 109,723,993 E55G probably benign Het
Zfp964 T C 8: 69,663,322 Y191H possibly damaging Het
Zfyve1 T C 12: 83,574,872 T250A probably damaging Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147580300 critical splice donor site probably null
IGL00469:Flt1 APN 5 147603605 missense probably damaging 0.99
IGL00897:Flt1 APN 5 147589854 missense probably benign 0.25
IGL01111:Flt1 APN 5 147578336 missense probably damaging 1.00
IGL01154:Flt1 APN 5 147576156 missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147571461 missense probably benign 0.01
IGL01973:Flt1 APN 5 147683889 missense probably benign 0.01
IGL02079:Flt1 APN 5 147568831 splice site probably benign
IGL02143:Flt1 APN 5 147578436 missense probably benign 0.00
IGL02156:Flt1 APN 5 147681741 missense probably damaging 0.99
IGL02345:Flt1 APN 5 147582626 missense probably benign 0.20
IGL02548:Flt1 APN 5 147639248 missense probably benign 0.00
IGL02631:Flt1 APN 5 147673574 nonsense probably null
IGL02686:Flt1 APN 5 147588602 missense probably damaging 1.00
IGL02938:Flt1 APN 5 147678299 missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147681924 nonsense probably null
IGL03196:Flt1 APN 5 147615127 critical splice donor site probably null
IGL03205:Flt1 APN 5 147699821 missense probably benign 0.00
IGL03255:Flt1 APN 5 147588521 splice site probably benign
flywheels UTSW 5 147599646 missense probably damaging 1.00
BB008:Flt1 UTSW 5 147588572 missense probably damaging 1.00
BB018:Flt1 UTSW 5 147588572 missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147655170 missense probably benign 0.32
PIT4402001:Flt1 UTSW 5 147678239 missense probably damaging 1.00
R0013:Flt1 UTSW 5 147571014 splice site probably benign
R0380:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R0448:Flt1 UTSW 5 147566394 splice site probably benign
R0789:Flt1 UTSW 5 147639483 missense probably damaging 1.00
R1005:Flt1 UTSW 5 147681885 missense probably damaging 0.99
R1241:Flt1 UTSW 5 147599646 missense probably damaging 1.00
R1302:Flt1 UTSW 5 147564240 missense possibly damaging 0.93
R1411:Flt1 UTSW 5 147580316 missense probably damaging 1.00
R1615:Flt1 UTSW 5 147639288 missense probably damaging 1.00
R1634:Flt1 UTSW 5 147676430 missense probably damaging 1.00
R1749:Flt1 UTSW 5 147655119 missense probably benign 0.00
R1768:Flt1 UTSW 5 147672709 missense probably damaging 1.00
R1972:Flt1 UTSW 5 147655093 splice site probably benign
R2074:Flt1 UTSW 5 147599606 missense possibly damaging 0.82
R2081:Flt1 UTSW 5 147639422 missense probably damaging 1.00
R2864:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147599593 missense probably damaging 1.00
R3820:Flt1 UTSW 5 147700017 splice site probably benign
R4089:Flt1 UTSW 5 147564241 missense probably benign 0.03
R4299:Flt1 UTSW 5 147683907 missense probably benign 0.00
R4570:Flt1 UTSW 5 147594613 missense probably damaging 1.00
R4812:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4853:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4865:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4900:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4906:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4909:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5072:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5073:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5074:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5218:Flt1 UTSW 5 147681928 missense probably damaging 1.00
R5547:Flt1 UTSW 5 147655138 missense probably damaging 1.00
R5731:Flt1 UTSW 5 147678152 missense probably benign 0.16
R5732:Flt1 UTSW 5 147634483 nonsense probably null
R5804:Flt1 UTSW 5 147580437 splice site probably null
R6107:Flt1 UTSW 5 147603593 missense probably benign 0.15
R6440:Flt1 UTSW 5 147564305 missense possibly damaging 0.79
R6453:Flt1 UTSW 5 147683941 missense possibly damaging 0.80
R6539:Flt1 UTSW 5 147578376 missense probably benign 0.27
R7068:Flt1 UTSW 5 147673634 missense probably damaging 1.00
R7112:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7195:Flt1 UTSW 5 147603576 missense probably damaging 1.00
R7255:Flt1 UTSW 5 147580406 missense probably damaging 1.00
R7347:Flt1 UTSW 5 147580381 missense probably damaging 1.00
R7469:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7473:Flt1 UTSW 5 147594595 missense probably damaging 1.00
R7663:Flt1 UTSW 5 147655120 missense probably benign
R7688:Flt1 UTSW 5 147676325 missense probably benign
R7729:Flt1 UTSW 5 147700367 missense probably benign 0.00
R7931:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R8051:Flt1 UTSW 5 147582691 missense probably benign 0.02
R8275:Flt1 UTSW 5 147678147 missense probably damaging 0.99
X0064:Flt1 UTSW 5 147673613 missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147681649 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AAGGATGCTCCAGACGAGTC -3'
(R):5'- AGAAACTACACTGCTTTGGGG -3'

Sequencing Primer
(F):5'- ATGCTCCAGACGAGTCTACTGAG -3'
(R):5'- ACTACACTGCTTTGGGGGACAG -3'
Posted On2016-10-28