Incidental Mutation 'R4930:Katnb1'
ID381156
Institutional Source Beutler Lab
Gene Symbol Katnb1
Ensembl Gene ENSMUSG00000031787
Gene Namekatanin p80 (WD40-containing) subunit B 1
Synonyms2410003J24Rik, KAT
MMRRC Submission 042531-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4930 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95081186-95103149 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 95097294 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034239] [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000212968] [ENSMUST00000213004]
Predicted Effect probably null
Transcript: ENSMUST00000034239
SMART Domains Protein: ENSMUSP00000034239
Gene: ENSMUSG00000031787

DomainStartEndE-ValueType
WD40 9 49 2.61e-3 SMART
WD40 52 91 2.45e-8 SMART
WD40 94 133 3.58e-10 SMART
WD40 136 175 7.49e-13 SMART
WD40 178 217 5.14e-11 SMART
WD40 220 258 1.14e-3 SMART
low complexity region 354 373 N/A INTRINSIC
low complexity region 396 412 N/A INTRINSIC
Pfam:Katanin_con80 496 654 8.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034240
SMART Domains Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
coiled coil region 100 360 N/A INTRINSIC
coiled coil region 393 430 N/A INTRINSIC
KISc 441 774 3.15e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169353
SMART Domains Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
coiled coil region 33 223 N/A INTRINSIC
coiled coil region 256 293 N/A INTRINSIC
KISc 304 637 3.15e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169748
SMART Domains Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
coiled coil region 34 324 N/A INTRINSIC
coiled coil region 357 394 N/A INTRINSIC
KISc 405 728 3.11e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212895
Predicted Effect probably benign
Transcript: ENSMUST00000212968
Predicted Effect probably benign
Transcript: ENSMUST00000213004
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules, polymers of alpha and beta tubulin subunits, form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules, while the p80 subunit targets the enzyme to the centrosome. Katanin is a member of the AAA family of ATPases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit embryonic lethality, small embryo, brain and limb bud size, variable eye defects, holoprosencephaly, and thin cerebral cortex with fewer cortical progenitors and post-mitotic neurons. Mutant MEFs form multiple centrioles, multipolar spindles, and supernumerary primary cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C T 12: 72,906,234 E242K possibly damaging Het
A930011G23Rik A G 5: 99,222,404 M499T possibly damaging Het
Abcb8 G A 5: 24,400,781 V196M possibly damaging Het
Ahnak T C 19: 9,010,967 M3205T possibly damaging Het
Ankrd1 A G 19: 36,115,033 Y265H probably damaging Het
Apeh A G 9: 108,087,825 S446P probably benign Het
Apip C A 2: 103,091,881 Y197* probably null Het
Arhgef11 T G 3: 87,728,594 V925G probably damaging Het
Arid4b T C 13: 14,187,477 V929A probably damaging Het
Asah2 T A 19: 32,052,906 D122V probably benign Het
B2m A T 2: 122,151,647 D116V possibly damaging Het
BC067074 G T 13: 113,327,662 G1453C probably damaging Het
Bhmt-ps1 A G 4: 26,369,184 noncoding transcript Het
Cacna1g T A 11: 94,444,073 I803F probably damaging Het
Ccdc43 A T 11: 102,690,285 V113E probably damaging Het
Cenpj A T 14: 56,534,781 Y388* probably null Het
Chd3 G A 11: 69,354,208 probably benign Het
Chil3 C T 3: 106,164,208 D47N possibly damaging Het
Colgalt2 A G 1: 152,499,959 T361A possibly damaging Het
Cops3 C A 11: 59,835,367 probably benign Het
Crb2 G T 2: 37,783,314 G74V probably damaging Het
Cyp20a1 A T 1: 60,366,719 Y224F probably damaging Het
Diaph3 A G 14: 87,141,166 probably benign Het
Dnah3 A T 7: 119,951,681 Y3127* probably null Het
Eef1akmt3 A C 10: 127,041,355 S14A possibly damaging Het
Ehf C A 2: 103,266,857 R250L probably damaging Het
Eps8l1 G A 7: 4,460,916 R13Q possibly damaging Het
Frem2 A C 3: 53,656,315 V257G possibly damaging Het
Gc T C 5: 89,439,589 T259A probably benign Het
Gm4952 A T 19: 12,627,012 N263Y probably benign Het
Gpcpd1 T A 2: 132,546,874 H326L probably damaging Het
Helz T C 11: 107,620,168 F617L probably damaging Het
Hoxb4 T C 11: 96,318,836 Y23H probably damaging Het
Hsf4 T A 8: 105,272,698 probably null Het
Ighv1-81 T C 12: 115,920,304 D109G probably damaging Het
Irx4 T C 13: 73,268,913 V476A probably benign Het
L3mbtl1 A G 2: 162,965,772 Y490C probably damaging Het
Lemd2 A G 17: 27,193,832 probably null Het
Lrrc38 A T 4: 143,369,868 T250S probably damaging Het
Map3k8 A T 18: 4,349,215 Y34* probably null Het
Mgst1 T A 6: 138,153,509 F79I probably benign Het
Midn T C 10: 80,155,355 S357P probably benign Het
Mmp3 T A 9: 7,447,640 D208E probably benign Het
Mrps26 A G 2: 130,564,942 E163G probably damaging Het
Mycbpap A T 11: 94,503,157 M371K probably benign Het
Mynn A C 3: 30,607,042 N91T probably damaging Het
Nek11 A G 9: 105,300,066 L292P probably damaging Het
Nid1 A T 13: 13,510,011 R1228W probably damaging Het
Nphs2 T C 1: 156,320,929 Y121H probably damaging Het
Olfr1020 T A 2: 85,849,893 I147N probably benign Het
Olfr1166 A C 2: 88,124,340 I215S probably benign Het
Olfr1178 G A 2: 88,391,940 R231H probably benign Het
Olfr1497 T C 19: 13,795,551 H20R probably benign Het
Olfr161 T G 16: 3,592,435 L13R probably damaging Het
Olfr204 C A 16: 59,314,873 C178F probably damaging Het
Olfr872 T C 9: 20,260,017 I59T probably damaging Het
P2rx7 C T 5: 122,670,479 T308M probably damaging Het
Prdx6 C T 1: 161,241,693 probably benign Het
Rad54b T A 4: 11,615,579 D862E probably damaging Het
Ripor1 A G 8: 105,617,182 Y344C probably damaging Het
Rnf112 T C 11: 61,453,465 M43V probably benign Het
Rp1l1 A G 14: 64,032,206 N1747S probably benign Het
Rps27 A G 3: 90,212,999 V22A probably damaging Het
Spaca1 A G 4: 34,044,236 V86A possibly damaging Het
Spdef A G 17: 27,718,162 Y156H probably damaging Het
Specc1 A C 11: 62,118,958 E433D possibly damaging Het
Srpr T A 9: 35,215,030 F506L probably benign Het
Stxbp5 A G 10: 9,760,866 probably benign Het
Syne1 C T 10: 5,052,777 R8046Q probably damaging Het
Tbx5 T A 5: 119,883,025 S365R probably benign Het
Terb1 G T 8: 104,447,948 P698Q probably benign Het
Tmbim7 T A 5: 3,661,948 Y27* probably null Het
Tmem106c C A 15: 97,965,028 A60E possibly damaging Het
Ttc26 A T 6: 38,391,540 Y174F probably damaging Het
Ttc6 T A 12: 57,673,823 probably null Het
Ttn T C 2: 76,732,370 I28747V possibly damaging Het
Unc13a C T 8: 71,630,504 probably null Het
Wdr81 T C 11: 75,451,924 D839G probably benign Het
Wfdc15a G C 2: 164,199,805 Q33E probably benign Het
Zfp456 T C 13: 67,366,946 R214G probably benign Het
Zfp457 T A 13: 67,294,100 Y137F probably damaging Het
Other mutations in Katnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Katnb1 APN 8 95098159 missense probably damaging 1.00
IGL02263:Katnb1 APN 8 95090075 missense probably damaging 1.00
IGL02896:Katnb1 APN 8 95096028 unclassified probably benign
H8562:Katnb1 UTSW 8 95095510 unclassified probably benign
R0139:Katnb1 UTSW 8 95098422 missense possibly damaging 0.90
R0418:Katnb1 UTSW 8 95095658 missense possibly damaging 0.92
R0503:Katnb1 UTSW 8 95095174 missense probably damaging 0.96
R1405:Katnb1 UTSW 8 95098173 missense probably damaging 1.00
R1405:Katnb1 UTSW 8 95098173 missense probably damaging 1.00
R3960:Katnb1 UTSW 8 95087297 missense possibly damaging 0.48
R4866:Katnb1 UTSW 8 95097504 missense possibly damaging 0.78
R5160:Katnb1 UTSW 8 95095470 missense probably benign 0.01
R5184:Katnb1 UTSW 8 95097980 missense possibly damaging 0.80
R5333:Katnb1 UTSW 8 95095606 missense possibly damaging 0.95
R5529:Katnb1 UTSW 8 95097672 missense probably damaging 0.99
R5848:Katnb1 UTSW 8 95098712 missense probably benign 0.09
R6424:Katnb1 UTSW 8 95093516 missense probably damaging 1.00
R6478:Katnb1 UTSW 8 95095456 missense possibly damaging 0.57
R6785:Katnb1 UTSW 8 95095642 missense probably benign 0.04
R7009:Katnb1 UTSW 8 95098384 missense probably damaging 0.99
R7174:Katnb1 UTSW 8 95097441 missense probably benign 0.00
R7253:Katnb1 UTSW 8 95095497 nonsense probably null
R7486:Katnb1 UTSW 8 95098729 missense probably damaging 1.00
R7718:Katnb1 UTSW 8 95095208 missense possibly damaging 0.78
R7996:Katnb1 UTSW 8 95098015 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AACTGTTGGGTCCCATCCAC -3'
(R):5'- ATGATGTCAGGTTCACCCTTG -3'

Sequencing Primer
(F):5'- AGGACCCTCACCTGCTGATG -3'
(R):5'- TTCACCCTTGGGTGCAGGAG -3'
Posted On2016-04-15