Incidental Mutation 'R5184:Katnb1'
ID397760
Institutional Source Beutler Lab
Gene Symbol Katnb1
Ensembl Gene ENSMUSG00000031787
Gene Namekatanin p80 (WD40-containing) subunit B 1
Synonyms2410003J24Rik, KAT
MMRRC Submission 042763-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5184 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95081186-95103149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95097980 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 534 (I534N)
Ref Sequence ENSEMBL: ENSMUSP00000034239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034239] [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000212968] [ENSMUST00000213004]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034239
AA Change: I534N

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034239
Gene: ENSMUSG00000031787
AA Change: I534N

DomainStartEndE-ValueType
WD40 9 49 2.61e-3 SMART
WD40 52 91 2.45e-8 SMART
WD40 94 133 3.58e-10 SMART
WD40 136 175 7.49e-13 SMART
WD40 178 217 5.14e-11 SMART
WD40 220 258 1.14e-3 SMART
low complexity region 354 373 N/A INTRINSIC
low complexity region 396 412 N/A INTRINSIC
Pfam:Katanin_con80 496 654 8.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034240
SMART Domains Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
coiled coil region 100 360 N/A INTRINSIC
coiled coil region 393 430 N/A INTRINSIC
KISc 441 774 3.15e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169353
SMART Domains Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
coiled coil region 33 223 N/A INTRINSIC
coiled coil region 256 293 N/A INTRINSIC
KISc 304 637 3.15e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169748
SMART Domains Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
coiled coil region 34 324 N/A INTRINSIC
coiled coil region 357 394 N/A INTRINSIC
KISc 405 728 3.11e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212895
Predicted Effect probably benign
Transcript: ENSMUST00000212968
Predicted Effect probably benign
Transcript: ENSMUST00000213004
Meta Mutation Damage Score 0.6416 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules, polymers of alpha and beta tubulin subunits, form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules, while the p80 subunit targets the enzyme to the centrosome. Katanin is a member of the AAA family of ATPases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit embryonic lethality, small embryo, brain and limb bud size, variable eye defects, holoprosencephaly, and thin cerebral cortex with fewer cortical progenitors and post-mitotic neurons. Mutant MEFs form multiple centrioles, multipolar spindles, and supernumerary primary cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,895,739 probably null Het
Arid3a A G 10: 79,950,769 E452G possibly damaging Het
Barhl2 A G 5: 106,457,640 S68P unknown Het
BC030499 T C 11: 78,292,747 F194L probably benign Het
Carf T C 1: 60,108,174 S17P probably damaging Het
Ccdc90b A G 7: 92,574,811 D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Daam2 A G 17: 49,494,391 I106T possibly damaging Het
Dmtf1 A G 5: 9,126,641 V437A probably benign Het
E2f2 A T 4: 136,184,440 Y254F possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Ern2 T C 7: 122,179,959 T221A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fermt1 A G 2: 132,941,963 V42A possibly damaging Het
Fgf3 A G 7: 144,842,810 D187G probably damaging Het
Flnb T A 14: 7,901,945 V936E probably damaging Het
Gm5415 A T 1: 32,545,648 C394S probably damaging Het
Herc2 T C 7: 56,122,351 Y1093H probably damaging Het
Invs A G 4: 48,283,242 probably benign Het
Kcnq5 A T 1: 21,402,487 D826E probably damaging Het
Klra9 A T 6: 130,188,712 N113K probably benign Het
Knl1 A G 2: 119,069,176 K453E probably damaging Het
Lgi4 C T 7: 31,070,757 probably benign Het
Lpin3 A G 2: 160,897,138 S289G probably benign Het
Mapre1 T A 2: 153,758,067 V137E possibly damaging Het
Mark4 A G 7: 19,447,243 F144L possibly damaging Het
Mogat2 G T 7: 99,223,635 A114E possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nell2 A G 15: 95,527,809 L19P possibly damaging Het
Nfia A T 4: 97,783,348 K98N probably damaging Het
Nutm1 T A 2: 112,249,000 T857S possibly damaging Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Olfr298 TG T 7: 86,489,291 probably null Het
Olfr68 T C 7: 103,777,404 K314E probably benign Het
Pde10a T C 17: 8,977,155 L706P probably damaging Het
Penk A G 4: 4,134,296 L117P probably damaging Het
Pgap1 A G 1: 54,481,856 S876P probably damaging Het
Pmfbp1 T C 8: 109,527,767 I478T possibly damaging Het
Pole G A 5: 110,294,934 E318K possibly damaging Het
Prr12 C A 7: 45,046,377 V1222L unknown Het
Prune2 T C 19: 17,216,357 S3070P possibly damaging Het
Rnf19a A G 15: 36,244,196 C573R probably benign Het
Rp1l1 T C 14: 64,030,180 S1072P probably damaging Het
Sh3pxd2a T C 19: 47,273,411 N315S possibly damaging Het
Snph T C 2: 151,594,544 I86V probably damaging Het
Sox6 A G 7: 115,777,228 Y90H probably damaging Het
Tbc1d13 T A 2: 30,142,311 C145S probably benign Het
Tcp11l1 T C 2: 104,699,944 E65G probably damaging Het
Thrb G T 14: 18,011,181 E186* probably null Het
Tmem101 A G 11: 102,156,233 Y38H possibly damaging Het
Tusc5 T A 11: 76,680,308 L50Q probably damaging Het
Urb1 A T 16: 90,783,274 probably null Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Usp25 A G 16: 77,109,227 E857G probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr35 T C 12: 9,018,142 L775P probably damaging Het
Xpnpep1 T C 19: 53,013,414 T134A probably benign Het
Zbtb10 T C 3: 9,264,671 V363A probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Katnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Katnb1 APN 8 95098159 missense probably damaging 1.00
IGL02263:Katnb1 APN 8 95090075 missense probably damaging 1.00
IGL02896:Katnb1 APN 8 95096028 unclassified probably benign
H8562:Katnb1 UTSW 8 95095510 unclassified probably benign
R0139:Katnb1 UTSW 8 95098422 missense possibly damaging 0.90
R0418:Katnb1 UTSW 8 95095658 missense possibly damaging 0.92
R0503:Katnb1 UTSW 8 95095174 missense probably damaging 0.96
R1405:Katnb1 UTSW 8 95098173 missense probably damaging 1.00
R1405:Katnb1 UTSW 8 95098173 missense probably damaging 1.00
R3960:Katnb1 UTSW 8 95087297 missense possibly damaging 0.48
R4866:Katnb1 UTSW 8 95097504 missense possibly damaging 0.78
R4930:Katnb1 UTSW 8 95097294 splice site probably null
R5160:Katnb1 UTSW 8 95095470 missense probably benign 0.01
R5333:Katnb1 UTSW 8 95095606 missense possibly damaging 0.95
R5529:Katnb1 UTSW 8 95097672 missense probably damaging 0.99
R5848:Katnb1 UTSW 8 95098712 missense probably benign 0.09
R6424:Katnb1 UTSW 8 95093516 missense probably damaging 1.00
R6478:Katnb1 UTSW 8 95095456 missense possibly damaging 0.57
R6785:Katnb1 UTSW 8 95095642 missense probably benign 0.04
R7009:Katnb1 UTSW 8 95098384 missense probably damaging 0.99
R7174:Katnb1 UTSW 8 95097441 missense probably benign 0.00
R7253:Katnb1 UTSW 8 95095497 nonsense probably null
R7486:Katnb1 UTSW 8 95098729 missense probably damaging 1.00
R7718:Katnb1 UTSW 8 95095208 missense possibly damaging 0.78
R7996:Katnb1 UTSW 8 95098015 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTGTGTTAGAGCAGCCAGC -3'
(R):5'- ATTGACAGCTGCAGGGTTTG -3'

Sequencing Primer
(F):5'- GCTTCCATCAGCTGAGCACTG -3'
(R):5'- CTGCAGCAGTTTCTCGATCTGG -3'
Posted On2016-07-06