Mutagenetix > Incidental Mutation

Incidental Mutation 'R4930:Rp1l1'

381189

Institutional Source

Beutler Lab

Gene Symbol

Rp1l1

Ensembl Gene

ENSMUSG00000046049

Gene Name

retinitis pigmentosa 1 homolog like 1

Synonyms

Dcdc4, Rp1hl1

MMRRC Submission

042531-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R4930 (G1)

Quality Score

209

Status

Validated

Chromosome

Chromosomal Location

63992506-64035025 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64032206 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1747 (N1747S)

Ref Sequence

ENSEMBL: ENSMUSP00000055449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058229]

AlphaFold

Q8CGM2

Predicted Effect

probably benign
Transcript: ENSMUST00000058229
AA Change: N1747S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: N1747S

Domain	Start	End	E-Value	Type
low complexity region	11	21	N/A	INTRINSIC
DCX	37	121	1.58e-13	SMART
DCX	155	239	1e-15	SMART
low complexity region	709	728	N/A	INTRINSIC
low complexity region	870	884	N/A	INTRINSIC
low complexity region	1159	1177	N/A	INTRINSIC
low complexity region	1228	1239	N/A	INTRINSIC
low complexity region	1612	1618	N/A	INTRINSIC
low complexity region	1642	1652	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224314

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.1%

Validation Efficiency

99% (88/89)

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	C	T	12: 72,906,234	E242K	possibly damaging	Het
A930011G23Rik	A	G	5: 99,222,404	M499T	possibly damaging	Het
Abcb8	G	A	5: 24,400,781	V196M	possibly damaging	Het
Ahnak	T	C	19: 9,010,967	M3205T	possibly damaging	Het
Ankrd1	A	G	19: 36,115,033	Y265H	probably damaging	Het
Apeh	A	G	9: 108,087,825	S446P	probably benign	Het
Apip	C	A	2: 103,091,881	Y197*	probably null	Het
Arhgef11	T	G	3: 87,728,594	V925G	probably damaging	Het
Arid4b	T	C	13: 14,187,477	V929A	probably damaging	Het
Asah2	T	A	19: 32,052,906	D122V	probably benign	Het
B2m	A	T	2: 122,151,647	D116V	possibly damaging	Het
BC067074	G	T	13: 113,327,662	G1453C	probably damaging	Het
Bhmt-ps1	A	G	4: 26,369,184		noncoding transcript	Het
Cacna1g	T	A	11: 94,444,073	I803F	probably damaging	Het
Ccdc43	A	T	11: 102,690,285	V113E	probably damaging	Het
Cenpj	A	T	14: 56,534,781	Y388*	probably null	Het
Chd3	G	A	11: 69,354,208		probably benign	Het
Chil3	C	T	3: 106,164,208	D47N	possibly damaging	Het
Colgalt2	A	G	1: 152,499,959	T361A	possibly damaging	Het
Cops3	C	A	11: 59,835,367		probably benign	Het
Crb2	G	T	2: 37,783,314	G74V	probably damaging	Het
Cyp20a1	A	T	1: 60,366,719	Y224F	probably damaging	Het
Diaph3	A	G	14: 87,141,166		probably benign	Het
Dnah3	A	T	7: 119,951,681	Y3127*	probably null	Het
Eef1akmt3	A	C	10: 127,041,355	S14A	possibly damaging	Het
Ehf	C	A	2: 103,266,857	R250L	probably damaging	Het
Eps8l1	G	A	7: 4,460,916	R13Q	possibly damaging	Het
Frem2	A	C	3: 53,656,315	V257G	possibly damaging	Het
Gc	T	C	5: 89,439,589	T259A	probably benign	Het
Gm4952	A	T	19: 12,627,012	N263Y	probably benign	Het
Gpcpd1	T	A	2: 132,546,874	H326L	probably damaging	Het
Helz	T	C	11: 107,620,168	F617L	probably damaging	Het
Hoxb4	T	C	11: 96,318,836	Y23H	probably damaging	Het
Hsf4	T	A	8: 105,272,698		probably null	Het
Ighv1-81	T	C	12: 115,920,304	D109G	probably damaging	Het
Irx4	T	C	13: 73,268,913	V476A	probably benign	Het
Katnb1	T	A	8: 95,097,294		probably null	Het
L3mbtl1	A	G	2: 162,965,772	Y490C	probably damaging	Het
Lemd2	A	G	17: 27,193,832		probably null	Het
Lrrc38	A	T	4: 143,369,868	T250S	probably damaging	Het
Map3k8	A	T	18: 4,349,215	Y34*	probably null	Het
Mgst1	T	A	6: 138,153,509	F79I	probably benign	Het
Midn	T	C	10: 80,155,355	S357P	probably benign	Het
Mmp3	T	A	9: 7,447,640	D208E	probably benign	Het
Mrps26	A	G	2: 130,564,942	E163G	probably damaging	Het
Mycbpap	A	T	11: 94,503,157	M371K	probably benign	Het
Mynn	A	C	3: 30,607,042	N91T	probably damaging	Het
Nek11	A	G	9: 105,300,066	L292P	probably damaging	Het
Nid1	A	T	13: 13,510,011	R1228W	probably damaging	Het
Nphs2	T	C	1: 156,320,929	Y121H	probably damaging	Het
Olfr1020	T	A	2: 85,849,893	I147N	probably benign	Het
Olfr1166	A	C	2: 88,124,340	I215S	probably benign	Het
Olfr1178	G	A	2: 88,391,940	R231H	probably benign	Het
Olfr1497	T	C	19: 13,795,551	H20R	probably benign	Het
Olfr161	T	G	16: 3,592,435	L13R	probably damaging	Het
Olfr204	C	A	16: 59,314,873	C178F	probably damaging	Het
Olfr872	T	C	9: 20,260,017	I59T	probably damaging	Het
P2rx7	C	T	5: 122,670,479	T308M	probably damaging	Het
Prdx6	C	T	1: 161,241,693		probably benign	Het
Rad54b	T	A	4: 11,615,579	D862E	probably damaging	Het
Ripor1	A	G	8: 105,617,182	Y344C	probably damaging	Het
Rnf112	T	C	11: 61,453,465	M43V	probably benign	Het
Rps27	A	G	3: 90,212,999	V22A	probably damaging	Het
Spaca1	A	G	4: 34,044,236	V86A	possibly damaging	Het
Spdef	A	G	17: 27,718,162	Y156H	probably damaging	Het
Specc1	A	C	11: 62,118,958	E433D	possibly damaging	Het
Srpr	T	A	9: 35,215,030	F506L	probably benign	Het
Stxbp5	A	G	10: 9,760,866		probably benign	Het
Syne1	C	T	10: 5,052,777	R8046Q	probably damaging	Het
Tbx5	T	A	5: 119,883,025	S365R	probably benign	Het
Terb1	G	T	8: 104,447,948	P698Q	probably benign	Het
Tmbim7	T	A	5: 3,661,948	Y27*	probably null	Het
Tmem106c	C	A	15: 97,965,028	A60E	possibly damaging	Het
Ttc26	A	T	6: 38,391,540	Y174F	probably damaging	Het
Ttc6	T	A	12: 57,673,823		probably null	Het
Ttn	T	C	2: 76,732,370	I28747V	possibly damaging	Het
Unc13a	C	T	8: 71,630,504		probably null	Het
Wdr81	T	C	11: 75,451,924	D839G	probably benign	Het
Wfdc15a	G	C	2: 164,199,805	Q33E	probably benign	Het
Zfp456	T	C	13: 67,366,946	R214G	probably benign	Het
Zfp457	T	A	13: 67,294,100	Y137F	probably damaging	Het

Other mutations in Rp1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Rp1l1	APN	14	64028725	missense	probably benign	0.01
IGL02063:Rp1l1	APN	14	64029536	missense	probably damaging	0.99
IGL02132:Rp1l1	APN	14	64028810	missense	probably benign
IGL02430:Rp1l1	APN	14	64029286	missense	probably benign	0.00
IGL02977:Rp1l1	APN	14	64028150	missense	probably benign	0.01
IGL03213:Rp1l1	APN	14	64028415	missense	probably damaging	0.98
IGL03346:Rp1l1	APN	14	64029440	missense	probably benign
R0085:Rp1l1	UTSW	14	64022295	missense	probably damaging	0.99
R0347:Rp1l1	UTSW	14	64030804	nonsense	probably null
R0362:Rp1l1	UTSW	14	64031066	nonsense	probably null
R0369:Rp1l1	UTSW	14	64029388	missense	possibly damaging	0.84
R0538:Rp1l1	UTSW	14	64022092	missense	probably damaging	1.00
R0544:Rp1l1	UTSW	14	64032066	missense	probably benign	0.00
R0780:Rp1l1	UTSW	14	64030351	missense	possibly damaging	0.94
R0944:Rp1l1	UTSW	14	64032232	missense	probably benign	0.05
R1051:Rp1l1	UTSW	14	64032535	missense	probably damaging	0.99
R1126:Rp1l1	UTSW	14	64030469	missense	probably damaging	1.00
R1450:Rp1l1	UTSW	14	64028150	missense	probably benign	0.01
R1483:Rp1l1	UTSW	14	64029047	missense	possibly damaging	0.76
R1508:Rp1l1	UTSW	14	64030892	missense	possibly damaging	0.83
R1553:Rp1l1	UTSW	14	64031894	missense	probably benign	0.00
R1651:Rp1l1	UTSW	14	64030993	missense	probably damaging	0.97
R1682:Rp1l1	UTSW	14	64028968	missense	probably damaging	0.98
R1809:Rp1l1	UTSW	14	64027966	missense	probably benign	0.18
R1885:Rp1l1	UTSW	14	64028390	missense	probably benign	0.01
R1887:Rp1l1	UTSW	14	64028390	missense	probably benign	0.01
R1898:Rp1l1	UTSW	14	64031590	missense	probably benign	0.04
R1924:Rp1l1	UTSW	14	64031543	missense	probably benign
R1939:Rp1l1	UTSW	14	64029593	missense	probably benign
R1941:Rp1l1	UTSW	14	64022252	missense	probably damaging	1.00
R2129:Rp1l1	UTSW	14	64028966	missense	possibly damaging	0.93
R2363:Rp1l1	UTSW	14	64029998	missense	possibly damaging	0.55
R3894:Rp1l1	UTSW	14	64029307	missense	probably benign
R3974:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R3975:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R3976:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R4072:Rp1l1	UTSW	14	64028132	missense	probably damaging	1.00
R4672:Rp1l1	UTSW	14	64031270	missense	probably damaging	1.00
R4673:Rp1l1	UTSW	14	64031270	missense	probably damaging	1.00
R4749:Rp1l1	UTSW	14	64029800	missense	probably damaging	0.99
R4755:Rp1l1	UTSW	14	64030070	missense	probably benign	0.34
R4877:Rp1l1	UTSW	14	64026171	missense	probably benign	0.00
R5039:Rp1l1	UTSW	14	64031356	missense	probably benign	0.21
R5106:Rp1l1	UTSW	14	64027946	missense	probably damaging	1.00
R5184:Rp1l1	UTSW	14	64030180	missense	probably damaging	1.00
R5215:Rp1l1	UTSW	14	64030013	missense	probably benign	0.01
R5409:Rp1l1	UTSW	14	64030621	missense	probably benign	0.02
R5575:Rp1l1	UTSW	14	64030984	missense	probably benign	0.23
R5696:Rp1l1	UTSW	14	64029746	missense	probably damaging	0.99
R5739:Rp1l1	UTSW	14	64032170	missense	probably benign	0.01
R5878:Rp1l1	UTSW	14	64028906	missense	probably benign	0.09
R6133:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6134:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6135:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6428:Rp1l1	UTSW	14	64032389	missense	possibly damaging	0.92
R6594:Rp1l1	UTSW	14	64031677	nonsense	probably null
R6736:Rp1l1	UTSW	14	64029724	missense	possibly damaging	0.93
R6800:Rp1l1	UTSW	14	64031150	missense	possibly damaging	0.92
R6848:Rp1l1	UTSW	14	64028218	missense	possibly damaging	0.79
R6878:Rp1l1	UTSW	14	64031852	missense	probably benign	0.00
R6922:Rp1l1	UTSW	14	64030385	missense	possibly damaging	0.93
R6980:Rp1l1	UTSW	14	64028720	missense	probably benign	0.02
R7053:Rp1l1	UTSW	14	64031509	missense	possibly damaging	0.68
R7151:Rp1l1	UTSW	14	64029026	missense	possibly damaging	0.73
R7291:Rp1l1	UTSW	14	64032298	missense	probably benign	0.10
R7335:Rp1l1	UTSW	14	64031998	missense	probably benign	0.00
R7344:Rp1l1	UTSW	14	64029620	missense	probably benign	0.00
R7470:Rp1l1	UTSW	14	64028566	missense	probably benign
R7570:Rp1l1	UTSW	14	64031574	nonsense	probably null
R7585:Rp1l1	UTSW	14	64030139	missense	probably damaging	0.96
R7591:Rp1l1	UTSW	14	64026109	missense	probably damaging	1.00
R7667:Rp1l1	UTSW	14	64029803	missense	probably benign	0.04
R7862:Rp1l1	UTSW	14	64028027	missense	probably damaging	1.00
R7935:Rp1l1	UTSW	14	64031225	missense	probably damaging	0.99
R8256:Rp1l1	UTSW	14	64028153	missense	probably benign	0.18
R8403:Rp1l1	UTSW	14	64028809	missense	probably benign	0.21
R8709:Rp1l1	UTSW	14	64031846	missense	probably damaging	0.98
R8817:Rp1l1	UTSW	14	64030636	missense	probably benign
R8971:Rp1l1	UTSW	14	64021996	missense	probably damaging	1.00
R9380:Rp1l1	UTSW	14	64029026	missense	probably benign	0.29
R9438:Rp1l1	UTSW	14	64028125	missense	possibly damaging	0.90
R9501:Rp1l1	UTSW	14	64028590	missense	probably benign	0.00
R9652:Rp1l1	UTSW	14	64032265	missense	probably damaging	1.00
R9683:Rp1l1	UTSW	14	64031677	missense	probably damaging	0.97
X0057:Rp1l1	UTSW	14	64030040	missense	probably benign	0.14
X0063:Rp1l1	UTSW	14	64029223	missense	probably damaging	0.98
Z1088:Rp1l1	UTSW	14	64028758	missense	possibly damaging	0.80
Z1088:Rp1l1	UTSW	14	64030378	missense	probably benign	0.01
Z1176:Rp1l1	UTSW	14	64029144	missense	probably damaging	1.00
Z1177:Rp1l1	UTSW	14	64032297	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCAGAGCTTTAGAGATGGAGGC -3'
(R):5'- ATACATCACGGGGACTTTCTTC -3'

Sequencing Primer
(F):5'- GCACTTTAGAGGCTCCAGCAAG -3'
(R):5'- ACGGGGACTTTCTTCTCTGCATG -3'

Posted On

2016-04-15