Incidental Mutation 'R4930:Rp1l1'
ID 381189
Institutional Source Beutler Lab
Gene Symbol Rp1l1
Ensembl Gene ENSMUSG00000046049
Gene Name retinitis pigmentosa 1 homolog like 1
Synonyms Dcdc4, Rp1hl1
MMRRC Submission 042531-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R4930 (G1)
Quality Score 209
Status Validated
Chromosome 14
Chromosomal Location 63992506-64035025 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64032206 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1747 (N1747S)
Ref Sequence ENSEMBL: ENSMUSP00000055449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058229]
AlphaFold Q8CGM2
Predicted Effect probably benign
Transcript: ENSMUST00000058229
AA Change: N1747S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: N1747S

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
DCX 37 121 1.58e-13 SMART
DCX 155 239 1e-15 SMART
low complexity region 709 728 N/A INTRINSIC
low complexity region 870 884 N/A INTRINSIC
low complexity region 1159 1177 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1612 1618 N/A INTRINSIC
low complexity region 1642 1652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224314
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C T 12: 72,906,234 E242K possibly damaging Het
A930011G23Rik A G 5: 99,222,404 M499T possibly damaging Het
Abcb8 G A 5: 24,400,781 V196M possibly damaging Het
Ahnak T C 19: 9,010,967 M3205T possibly damaging Het
Ankrd1 A G 19: 36,115,033 Y265H probably damaging Het
Apeh A G 9: 108,087,825 S446P probably benign Het
Apip C A 2: 103,091,881 Y197* probably null Het
Arhgef11 T G 3: 87,728,594 V925G probably damaging Het
Arid4b T C 13: 14,187,477 V929A probably damaging Het
Asah2 T A 19: 32,052,906 D122V probably benign Het
B2m A T 2: 122,151,647 D116V possibly damaging Het
BC067074 G T 13: 113,327,662 G1453C probably damaging Het
Bhmt-ps1 A G 4: 26,369,184 noncoding transcript Het
Cacna1g T A 11: 94,444,073 I803F probably damaging Het
Ccdc43 A T 11: 102,690,285 V113E probably damaging Het
Cenpj A T 14: 56,534,781 Y388* probably null Het
Chd3 G A 11: 69,354,208 probably benign Het
Chil3 C T 3: 106,164,208 D47N possibly damaging Het
Colgalt2 A G 1: 152,499,959 T361A possibly damaging Het
Cops3 C A 11: 59,835,367 probably benign Het
Crb2 G T 2: 37,783,314 G74V probably damaging Het
Cyp20a1 A T 1: 60,366,719 Y224F probably damaging Het
Diaph3 A G 14: 87,141,166 probably benign Het
Dnah3 A T 7: 119,951,681 Y3127* probably null Het
Eef1akmt3 A C 10: 127,041,355 S14A possibly damaging Het
Ehf C A 2: 103,266,857 R250L probably damaging Het
Eps8l1 G A 7: 4,460,916 R13Q possibly damaging Het
Frem2 A C 3: 53,656,315 V257G possibly damaging Het
Gc T C 5: 89,439,589 T259A probably benign Het
Gm4952 A T 19: 12,627,012 N263Y probably benign Het
Gpcpd1 T A 2: 132,546,874 H326L probably damaging Het
Helz T C 11: 107,620,168 F617L probably damaging Het
Hoxb4 T C 11: 96,318,836 Y23H probably damaging Het
Hsf4 T A 8: 105,272,698 probably null Het
Ighv1-81 T C 12: 115,920,304 D109G probably damaging Het
Irx4 T C 13: 73,268,913 V476A probably benign Het
Katnb1 T A 8: 95,097,294 probably null Het
L3mbtl1 A G 2: 162,965,772 Y490C probably damaging Het
Lemd2 A G 17: 27,193,832 probably null Het
Lrrc38 A T 4: 143,369,868 T250S probably damaging Het
Map3k8 A T 18: 4,349,215 Y34* probably null Het
Mgst1 T A 6: 138,153,509 F79I probably benign Het
Midn T C 10: 80,155,355 S357P probably benign Het
Mmp3 T A 9: 7,447,640 D208E probably benign Het
Mrps26 A G 2: 130,564,942 E163G probably damaging Het
Mycbpap A T 11: 94,503,157 M371K probably benign Het
Mynn A C 3: 30,607,042 N91T probably damaging Het
Nek11 A G 9: 105,300,066 L292P probably damaging Het
Nid1 A T 13: 13,510,011 R1228W probably damaging Het
Nphs2 T C 1: 156,320,929 Y121H probably damaging Het
Olfr1020 T A 2: 85,849,893 I147N probably benign Het
Olfr1166 A C 2: 88,124,340 I215S probably benign Het
Olfr1178 G A 2: 88,391,940 R231H probably benign Het
Olfr1497 T C 19: 13,795,551 H20R probably benign Het
Olfr161 T G 16: 3,592,435 L13R probably damaging Het
Olfr204 C A 16: 59,314,873 C178F probably damaging Het
Olfr872 T C 9: 20,260,017 I59T probably damaging Het
P2rx7 C T 5: 122,670,479 T308M probably damaging Het
Prdx6 C T 1: 161,241,693 probably benign Het
Rad54b T A 4: 11,615,579 D862E probably damaging Het
Ripor1 A G 8: 105,617,182 Y344C probably damaging Het
Rnf112 T C 11: 61,453,465 M43V probably benign Het
Rps27 A G 3: 90,212,999 V22A probably damaging Het
Spaca1 A G 4: 34,044,236 V86A possibly damaging Het
Spdef A G 17: 27,718,162 Y156H probably damaging Het
Specc1 A C 11: 62,118,958 E433D possibly damaging Het
Srpr T A 9: 35,215,030 F506L probably benign Het
Stxbp5 A G 10: 9,760,866 probably benign Het
Syne1 C T 10: 5,052,777 R8046Q probably damaging Het
Tbx5 T A 5: 119,883,025 S365R probably benign Het
Terb1 G T 8: 104,447,948 P698Q probably benign Het
Tmbim7 T A 5: 3,661,948 Y27* probably null Het
Tmem106c C A 15: 97,965,028 A60E possibly damaging Het
Ttc26 A T 6: 38,391,540 Y174F probably damaging Het
Ttc6 T A 12: 57,673,823 probably null Het
Ttn T C 2: 76,732,370 I28747V possibly damaging Het
Unc13a C T 8: 71,630,504 probably null Het
Wdr81 T C 11: 75,451,924 D839G probably benign Het
Wfdc15a G C 2: 164,199,805 Q33E probably benign Het
Zfp456 T C 13: 67,366,946 R214G probably benign Het
Zfp457 T A 13: 67,294,100 Y137F probably damaging Het
Other mutations in Rp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Rp1l1 APN 14 64028725 missense probably benign 0.01
IGL02063:Rp1l1 APN 14 64029536 missense probably damaging 0.99
IGL02132:Rp1l1 APN 14 64028810 missense probably benign
IGL02430:Rp1l1 APN 14 64029286 missense probably benign 0.00
IGL02977:Rp1l1 APN 14 64028150 missense probably benign 0.01
IGL03213:Rp1l1 APN 14 64028415 missense probably damaging 0.98
IGL03346:Rp1l1 APN 14 64029440 missense probably benign
R0085:Rp1l1 UTSW 14 64022295 missense probably damaging 0.99
R0347:Rp1l1 UTSW 14 64030804 nonsense probably null
R0362:Rp1l1 UTSW 14 64031066 nonsense probably null
R0369:Rp1l1 UTSW 14 64029388 missense possibly damaging 0.84
R0538:Rp1l1 UTSW 14 64022092 missense probably damaging 1.00
R0544:Rp1l1 UTSW 14 64032066 missense probably benign 0.00
R0780:Rp1l1 UTSW 14 64030351 missense possibly damaging 0.94
R0944:Rp1l1 UTSW 14 64032232 missense probably benign 0.05
R1051:Rp1l1 UTSW 14 64032535 missense probably damaging 0.99
R1126:Rp1l1 UTSW 14 64030469 missense probably damaging 1.00
R1450:Rp1l1 UTSW 14 64028150 missense probably benign 0.01
R1483:Rp1l1 UTSW 14 64029047 missense possibly damaging 0.76
R1508:Rp1l1 UTSW 14 64030892 missense possibly damaging 0.83
R1553:Rp1l1 UTSW 14 64031894 missense probably benign 0.00
R1651:Rp1l1 UTSW 14 64030993 missense probably damaging 0.97
R1682:Rp1l1 UTSW 14 64028968 missense probably damaging 0.98
R1809:Rp1l1 UTSW 14 64027966 missense probably benign 0.18
R1885:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1887:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1898:Rp1l1 UTSW 14 64031590 missense probably benign 0.04
R1924:Rp1l1 UTSW 14 64031543 missense probably benign
R1939:Rp1l1 UTSW 14 64029593 missense probably benign
R1941:Rp1l1 UTSW 14 64022252 missense probably damaging 1.00
R2129:Rp1l1 UTSW 14 64028966 missense possibly damaging 0.93
R2363:Rp1l1 UTSW 14 64029998 missense possibly damaging 0.55
R3894:Rp1l1 UTSW 14 64029307 missense probably benign
R3974:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3975:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3976:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R4072:Rp1l1 UTSW 14 64028132 missense probably damaging 1.00
R4672:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4673:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4749:Rp1l1 UTSW 14 64029800 missense probably damaging 0.99
R4755:Rp1l1 UTSW 14 64030070 missense probably benign 0.34
R4877:Rp1l1 UTSW 14 64026171 missense probably benign 0.00
R5039:Rp1l1 UTSW 14 64031356 missense probably benign 0.21
R5106:Rp1l1 UTSW 14 64027946 missense probably damaging 1.00
R5184:Rp1l1 UTSW 14 64030180 missense probably damaging 1.00
R5215:Rp1l1 UTSW 14 64030013 missense probably benign 0.01
R5409:Rp1l1 UTSW 14 64030621 missense probably benign 0.02
R5575:Rp1l1 UTSW 14 64030984 missense probably benign 0.23
R5696:Rp1l1 UTSW 14 64029746 missense probably damaging 0.99
R5739:Rp1l1 UTSW 14 64032170 missense probably benign 0.01
R5878:Rp1l1 UTSW 14 64028906 missense probably benign 0.09
R6133:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6134:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6135:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6428:Rp1l1 UTSW 14 64032389 missense possibly damaging 0.92
R6594:Rp1l1 UTSW 14 64031677 nonsense probably null
R6736:Rp1l1 UTSW 14 64029724 missense possibly damaging 0.93
R6800:Rp1l1 UTSW 14 64031150 missense possibly damaging 0.92
R6848:Rp1l1 UTSW 14 64028218 missense possibly damaging 0.79
R6878:Rp1l1 UTSW 14 64031852 missense probably benign 0.00
R6922:Rp1l1 UTSW 14 64030385 missense possibly damaging 0.93
R6980:Rp1l1 UTSW 14 64028720 missense probably benign 0.02
R7053:Rp1l1 UTSW 14 64031509 missense possibly damaging 0.68
R7151:Rp1l1 UTSW 14 64029026 missense possibly damaging 0.73
R7291:Rp1l1 UTSW 14 64032298 missense probably benign 0.10
R7335:Rp1l1 UTSW 14 64031998 missense probably benign 0.00
R7344:Rp1l1 UTSW 14 64029620 missense probably benign 0.00
R7470:Rp1l1 UTSW 14 64028566 missense probably benign
R7570:Rp1l1 UTSW 14 64031574 nonsense probably null
R7585:Rp1l1 UTSW 14 64030139 missense probably damaging 0.96
R7591:Rp1l1 UTSW 14 64026109 missense probably damaging 1.00
R7667:Rp1l1 UTSW 14 64029803 missense probably benign 0.04
R7862:Rp1l1 UTSW 14 64028027 missense probably damaging 1.00
R7935:Rp1l1 UTSW 14 64031225 missense probably damaging 0.99
R8256:Rp1l1 UTSW 14 64028153 missense probably benign 0.18
R8403:Rp1l1 UTSW 14 64028809 missense probably benign 0.21
R8709:Rp1l1 UTSW 14 64031846 missense probably damaging 0.98
R8817:Rp1l1 UTSW 14 64030636 missense probably benign
R8971:Rp1l1 UTSW 14 64021996 missense probably damaging 1.00
R9380:Rp1l1 UTSW 14 64029026 missense probably benign 0.29
R9438:Rp1l1 UTSW 14 64028125 missense possibly damaging 0.90
R9501:Rp1l1 UTSW 14 64028590 missense probably benign 0.00
R9652:Rp1l1 UTSW 14 64032265 missense probably damaging 1.00
R9683:Rp1l1 UTSW 14 64031677 missense probably damaging 0.97
X0057:Rp1l1 UTSW 14 64030040 missense probably benign 0.14
X0063:Rp1l1 UTSW 14 64029223 missense probably damaging 0.98
Z1088:Rp1l1 UTSW 14 64028758 missense possibly damaging 0.80
Z1088:Rp1l1 UTSW 14 64030378 missense probably benign 0.01
Z1176:Rp1l1 UTSW 14 64029144 missense probably damaging 1.00
Z1177:Rp1l1 UTSW 14 64032297 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGAGCTTTAGAGATGGAGGC -3'
(R):5'- ATACATCACGGGGACTTTCTTC -3'

Sequencing Primer
(F):5'- GCACTTTAGAGGCTCCAGCAAG -3'
(R):5'- ACGGGGACTTTCTTCTCTGCATG -3'
Posted On 2016-04-15