Incidental Mutation 'R4945:Txndc15'
ID381327
Institutional Source Beutler Lab
Gene Symbol Txndc15
Ensembl Gene ENSMUSG00000021497
Gene Namethioredoxin domain containing 15
Synonyms
MMRRC Submission 042542-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R4945 (G1)
Quality Score215
Status Not validated
Chromosome13
Chromosomal Location55714650-55726227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55718165 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 147 (D147E)
Ref Sequence ENSEMBL: ENSMUSP00000021959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021959]
Predicted Effect probably benign
Transcript: ENSMUST00000021959
AA Change: D147E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021959
Gene: ENSMUSG00000021497
AA Change: D147E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 174 278 8.6e-11 PFAM
transmembrane domain 305 324 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223649
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,677,075 C170S possibly damaging Het
Adamts13 G A 2: 26,986,610 R512H probably damaging Het
Adgrl2 T A 3: 148,823,036 M1158L probably damaging Het
Adgrl3 C A 5: 81,512,048 H153Q probably damaging Het
Aldh1a2 C A 9: 71,215,916 Q24K probably benign Het
Atp1b1 A G 1: 164,438,298 V298A probably damaging Het
Casp8ap2 T A 4: 32,631,163 N74K possibly damaging Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cerk C G 15: 86,156,601 D186H probably benign Het
Cmtr2 T C 8: 110,221,433 F125S probably damaging Het
Col6a1 A G 10: 76,712,272 V650A unknown Het
Cuzd1 A G 7: 131,316,621 F196L probably damaging Het
Esm1 T G 13: 113,210,145 probably null Het
Fbn2 T A 18: 58,050,253 I1787F possibly damaging Het
Gm1110 T C 9: 26,920,595 M87V possibly damaging Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
Grk2 A G 19: 4,290,447 I302T probably damaging Het
Hoxb6 A G 11: 96,299,259 Y28C possibly damaging Het
Ift27 A G 15: 78,164,254 V110A probably damaging Het
Igfbp7 T C 5: 77,351,257 D267G probably benign Het
Ighv1-49 C A 12: 115,055,408 V56L possibly damaging Het
Ighv8-8 C T 12: 115,294,261 M53I probably benign Het
Kcnj3 T A 2: 55,437,578 N126K probably damaging Het
Kif12 C T 4: 63,168,493 probably null Het
Lrif1 A C 3: 106,735,753 I725L probably damaging Het
Lrrk2 T C 15: 91,804,920 V2265A probably benign Het
Med25 T C 7: 44,883,102 N438S possibly damaging Het
Mex3b A T 7: 82,870,174 T566S probably benign Het
Mkx T C 18: 7,000,657 N95S possibly damaging Het
Morc3 A T 16: 93,871,194 D820V probably damaging Het
Mroh4 G T 15: 74,612,008 N562K probably benign Het
Ndst3 A T 3: 123,552,552 I276N probably damaging Het
Notch2 A G 3: 98,111,721 N733S probably benign Het
Olfr1025-ps1 T A 2: 85,918,573 I216N possibly damaging Het
Olfr1084 T C 2: 86,639,489 Y73C probably damaging Het
Olfr168 C A 16: 19,530,557 R121L probably benign Het
Olfr639 G A 7: 104,012,378 T108I possibly damaging Het
Olfr713 A T 7: 107,036,319 M55L probably benign Het
Olfr885 G T 9: 38,061,772 G151C probably damaging Het
Olfr907 A T 9: 38,499,289 I207F probably damaging Het
Olfr994 T C 2: 85,430,551 T93A probably benign Het
Patj A T 4: 98,495,064 N268Y probably damaging Het
Pbrm1 T A 14: 31,052,216 D446E probably damaging Het
Pcdhga11 A G 18: 37,758,032 T698A probably benign Het
Pde6a T C 18: 61,234,718 V266A probably damaging Het
Phax G T 18: 56,575,991 R209L probably damaging Het
Pld2 T A 11: 70,555,698 M20K probably damaging Het
Rabl3 T C 16: 37,541,858 S20P probably damaging Het
Rad51 T A 2: 119,127,148 V174E probably damaging Het
Rb1cc1 A G 1: 6,249,627 E1090G probably benign Het
Rfc3 T C 5: 151,642,985 E333G probably damaging Het
Rfx6 T G 10: 51,726,851 Y821* probably null Het
Riok3 A G 18: 12,128,915 D2G probably damaging Het
Rtn1 G T 12: 72,217,484 A183E probably damaging Het
Skint8 T C 4: 111,939,608 L303P probably damaging Het
Slc36a2 C A 11: 55,174,694 V162L probably benign Het
Sorcs3 T C 19: 48,764,148 V794A possibly damaging Het
Sspo A G 6: 48,467,087 probably null Het
Tbk1 T C 10: 121,551,269 N707S probably damaging Het
Tchhl1 A T 3: 93,471,576 H529L probably benign Het
Tgfbr2 A T 9: 116,131,565 H106Q probably benign Het
Trim8 A G 19: 46,502,775 E111G probably benign Het
Tshz2 A G 2: 169,883,874 Y130C probably damaging Het
Vmn1r172 T A 7: 23,660,320 L210H possibly damaging Het
Vmn1r55 A G 7: 5,147,106 V106A probably damaging Het
Vmn2r49 T A 7: 9,986,287 K426* probably null Het
Wnk2 C T 13: 49,057,246 R206Q probably damaging Het
Zfp473 T C 7: 44,734,564 N115S probably benign Het
Zfp536 G T 7: 37,569,736 A85D probably damaging Het
Zfp853 C A 5: 143,288,829 Q345H unknown Het
Other mutations in Txndc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Txndc15 APN 13 55725675 missense probably damaging 1.00
IGL01634:Txndc15 APN 13 55721625 missense probably damaging 0.99
PIT4791001:Txndc15 UTSW 13 55721694 missense probably benign 0.39
R0309:Txndc15 UTSW 13 55724582 missense probably damaging 1.00
R0480:Txndc15 UTSW 13 55724623 missense possibly damaging 0.91
R1473:Txndc15 UTSW 13 55721574 splice site probably benign
R1856:Txndc15 UTSW 13 55718062 missense possibly damaging 0.80
R4456:Txndc15 UTSW 13 55718164 missense possibly damaging 0.82
R5159:Txndc15 UTSW 13 55717921 missense probably benign
R5376:Txndc15 UTSW 13 55718219 missense probably damaging 1.00
R5776:Txndc15 UTSW 13 55718107 missense probably benign 0.01
R7365:Txndc15 UTSW 13 55714788 missense unknown
R7392:Txndc15 UTSW 13 55721586 missense probably damaging 1.00
R7557:Txndc15 UTSW 13 55717954 missense probably benign 0.05
R7679:Txndc15 UTSW 13 55725808 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCATGAAGAGGAGGTTGCTC -3'
(R):5'- CATCCATCCGAAAGCTGATGAG -3'

Sequencing Primer
(F):5'- AGGAGGTTGCTCAGGACCATC -3'
(R):5'- CCATCCGAAAGCTGATGAGTATTAG -3'
Posted On2016-04-27