Mutagenetix > Incidental Mutations

Incidental Mutation 'R5016:Llgl2'

385589

Institutional Source

Beutler Lab

Gene Symbol

Llgl2

Ensembl Gene

ENSMUSG00000020782

Gene Name

LLGL2 scribble cell polarity complex component

Synonyms

9130006H11Rik

MMRRC Submission

042607-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.253) question?

Stock #

R5016 (G1)

Quality Score

191

Status

Validated

Chromosome

Chromosomal Location

115824049-115855780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115853424 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 843 (E843G)

Ref Sequence

ENSEMBL: ENSMUSP00000136054 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093911] [ENSMUST00000103032] [ENSMUST00000177736]

Predicted Effect

probably benign
Transcript: ENSMUST00000093911

SMART Domains

Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427

Domain	Start	End	E-Value	Type
MYSc	1	640	2.4e-134	SMART
IQ	660	682	1.03e1	SMART
Pfam:MyTH4	837	945	2.1e-23	PFAM
low complexity region	1050	1068	N/A	INTRINSIC
low complexity region	1136	1170	N/A	INTRINSIC
low complexity region	1207	1246	N/A	INTRINSIC
low complexity region	1302	1327	N/A	INTRINSIC
low complexity region	1454	1468	N/A	INTRINSIC
low complexity region	1489	1509	N/A	INTRINSIC
SH3	1735	1792	1.15e-7	SMART
Pfam:MyTH4	1928	2029	8.3e-25	PFAM
B41	2032	2235	6.99e-4	SMART
low complexity region	2243	2253	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000103032
AA Change: E819G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782
AA Change: E819G

Domain	Start	End	E-Value	Type
WD40	24	60	9.17e1	SMART
WD40	62	101	7.96e0	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	3.96e1	SMART
WD40	221	258	5.7e1	SMART
Pfam:LLGL	268	372	3.2e-47	PFAM
WD40	411	451	1.38e0	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	830	879	2e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000128826

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130518

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132999

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137951

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147878

Predicted Effect

probably damaging
Transcript: ENSMUST00000177736
AA Change: E843G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782
AA Change: E843G

Domain	Start	End	E-Value	Type
WD40	24	60	5.9e-1	SMART
WD40	62	101	5.2e-2	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	2.5e-1	SMART
WD40	221	258	3.6e-1	SMART
Pfam:LLGL	271	372	6.2e-41	PFAM
WD40	411	451	8.8e-3	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	854	903	2e-10	BLAST

Meta Mutation Damage Score

0.6503

Coding Region Coverage

1x: 98.3%
3x: 97.2%
10x: 95.1%
20x: 91.0%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit abnormal branching morphogenesis of the placental labyrinth layer and are born as runts but catch up in size by adulthood. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	C	T	16: 56,671,268	P768S	probably damaging	Het
Adprhl1	A	G	8: 13,224,889	L623P	possibly damaging	Het
Anapc1	A	T	2: 128,607,175		probably benign	Het
Ankzf1	C	A	1: 75,195,978		probably benign	Het
Ash1l	A	G	3: 88,982,323	D503G	probably damaging	Het
Atp7b	T	C	8: 22,015,869		probably null	Het
Bach1	T	A	16: 87,719,318	V249D	possibly damaging	Het
Ccdc158	A	G	5: 92,657,892	S335P	probably benign	Het
Chd9	T	A	8: 91,006,626	C1374*	probably null	Het
Col16a1	C	T	4: 130,079,195	T643M	probably benign	Het
Cygb	A	G	11: 116,650,014	F49L	probably benign	Het
Dnah17	G	C	11: 118,080,766	T2147S	probably damaging	Het
Drd3	C	A	16: 43,762,246	A34E	possibly damaging	Het
Ephb6	G	A	6: 41,618,107	R685Q	probably benign	Het
Ezh1	G	A	11: 101,199,237		probably benign	Het
Gpr19	T	A	6: 134,869,917	K231*	probably null	Het
Gpr61	A	G	3: 108,150,667	V226A	possibly damaging	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Hnrnpul2	A	G	19: 8,822,825	K185R	possibly damaging	Het
Igsf9	A	C	1: 172,490,712	T140P	probably damaging	Het
Ksr2	A	G	5: 117,500,792	D87G	probably benign	Het
Ltbp4	GT	G	7: 27,327,685		probably null	Het
Luc7l2	A	G	6: 38,585,101	I20V	possibly damaging	Het
Mcm6	G	A	1: 128,343,427	T485M	probably damaging	Het
Miox	A	G	15: 89,335,564	D85G	probably null	Het
Nudt18	T	C	14: 70,579,463	F169S	probably benign	Het
Nxpe4	A	G	9: 48,392,885	N91D	probably benign	Het
Olfr1089	T	G	2: 86,732,746	I289L	probably benign	Het
Olfr155	T	C	4: 43,854,596	S96P	probably benign	Het
Olfr811	A	G	10: 129,801,793	V244A	probably benign	Het
Pdss2	G	T	10: 43,222,005	A82S	probably damaging	Het
Ptprs	T	C	17: 56,419,070	D998G	probably damaging	Het
Rasd2	C	A	8: 75,221,975	N176K	probably damaging	Het
Serpinb3a	A	G	1: 107,046,330	F284L	probably damaging	Het
Skint6	T	A	4: 113,171,533		probably null	Het
Slc12a6	C	T	2: 112,356,627		probably benign	Het
Slc22a19	G	A	19: 7,674,372	T490M	probably benign	Het
Sp2	A	T	11: 96,955,832	C562S	probably damaging	Het
Specc1	A	G	11: 62,118,957	E433G	possibly damaging	Het
Sspo	C	T	6: 48,452,280	Q451*	probably null	Het
St6galnac1	A	T	11: 116,765,880	S478T	probably damaging	Het
Steap4	C	T	5: 7,976,699	R221*	probably null	Het
Ugt1a5	C	G	1: 88,166,241	R64G	probably benign	Het
Vmn1r202	A	T	13: 22,502,205	F14Y	probably damaging	Het
Vmn2r79	T	C	7: 87,037,340	V643A	probably benign	Het
Vmn2r91	C	A	17: 18,110,060	Y535*	probably null	Het
Wdr3	A	T	3: 100,141,620		probably benign	Het
Wdr95	T	C	5: 149,544,801	M41T	probably benign	Het

Other mutations in Llgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Llgl2	APN	11	115834884	missense	probably benign	0.00
IGL01145:Llgl2	APN	11	115853805	missense	probably benign
IGL01344:Llgl2	APN	11	115851193	missense	probably benign	0.01
IGL01980:Llgl2	APN	11	115850025	missense	probably damaging	1.00
IGL02220:Llgl2	APN	11	115845379	missense	possibly damaging	0.64
IGL02341:Llgl2	APN	11	115851120	missense	possibly damaging	0.70
IGL02399:Llgl2	APN	11	115844835	missense	probably damaging	0.97
IGL02415:Llgl2	APN	11	115853285	missense	probably damaging	0.98
IGL02632:Llgl2	APN	11	115844872	missense	probably damaging	1.00
IGL02990:Llgl2	APN	11	115854333	missense	probably benign	0.01
IGL03405:Llgl2	APN	11	115850842	missense	probably benign	0.09
R0097:Llgl2	UTSW	11	115844497	nonsense	probably null
R0166:Llgl2	UTSW	11	115844854	missense	probably damaging	1.00
R0277:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0323:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0345:Llgl2	UTSW	11	115849992	splice site	probably benign
R0614:Llgl2	UTSW	11	115850267	missense	probably damaging	1.00
R0980:Llgl2	UTSW	11	115850001	missense	probably damaging	1.00
R1387:Llgl2	UTSW	11	115853132	missense	probably damaging	0.99
R1456:Llgl2	UTSW	11	115845499	missense	probably benign	0.00
R1541:Llgl2	UTSW	11	115853121	missense	probably benign	0.00
R1832:Llgl2	UTSW	11	115851100	missense	probably damaging	1.00
R1950:Llgl2	UTSW	11	115851066	missense	probably damaging	0.96
R2991:Llgl2	UTSW	11	115851120	missense	probably benign	0.05
R4018:Llgl2	UTSW	11	115847612	missense	probably benign	0.31
R4582:Llgl2	UTSW	11	115850706	missense	possibly damaging	0.89
R4729:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R4907:Llgl2	UTSW	11	115853974	nonsense	probably null
R5000:Llgl2	UTSW	11	115844902	missense	probably benign
R5175:Llgl2	UTSW	11	115850721	missense	probably damaging	1.00
R5857:Llgl2	UTSW	11	115850281	missense	probably damaging	1.00
R6190:Llgl2	UTSW	11	115846986	missense	probably benign	0.00
R6451:Llgl2	UTSW	11	115844941	missense	probably damaging	0.99
R6804:Llgl2	UTSW	11	115843315	critical splice acceptor site	probably null
R6909:Llgl2	UTSW	11	115850799	missense	probably damaging	1.00
R7324:Llgl2	UTSW	11	115850730	missense	possibly damaging	0.49
R7332:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R7715:Llgl2	UTSW	11	115849728	missense	probably benign
R8038:Llgl2	UTSW	11	115851103	missense	probably benign	0.17
R8069:Llgl2	UTSW	11	115853286	missense	probably damaging	0.99
X0058:Llgl2	UTSW	11	115850637	missense	probably damaging	0.99
Z1176:Llgl2	UTSW	11	115849554	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AACAGATGAACCTGTCCGGG -3'
(R):5'- CTTTGGGTCTAAGGCTGACAC -3'

Sequencing Primer
(F):5'- AACACAGAGGGCCCGATCTTG -3'
(R):5'- GGTCTAAGGCTGACACATACAAGATC -3'

Posted On

2016-05-10