Mutagenetix > Incidental Mutations

Incidental Mutation 'R1832:Llgl2'

204885

Institutional Source

Beutler Lab

Gene Symbol

Llgl2

Ensembl Gene

ENSMUSG00000020782

Gene Name

LLGL2 scribble cell polarity complex component

Synonyms

9130006H11Rik

MMRRC Submission

039859-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.659) question?

Stock #

R1832 (G1)

Quality Score

206

Status

Validated

Chromosome

Chromosomal Location

115824049-115855780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 115851100 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 656 (R656L)

Ref Sequence

ENSEMBL: ENSMUSP00000136054 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103032] [ENSMUST00000177736]

Predicted Effect

probably damaging
Transcript: ENSMUST00000103032
AA Change: R656L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782
AA Change: R656L

Domain	Start	End	E-Value	Type
WD40	24	60	9.17e1	SMART
WD40	62	101	7.96e0	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	3.96e1	SMART
WD40	221	258	5.7e1	SMART
Pfam:LLGL	268	372	3.2e-47	PFAM
WD40	411	451	1.38e0	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	830	879	2e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000128826

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130518

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132999

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137951

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147878

Predicted Effect

probably damaging
Transcript: ENSMUST00000177736
AA Change: R656L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782
AA Change: R656L

Domain	Start	End	E-Value	Type
WD40	24	60	5.9e-1	SMART
WD40	62	101	5.2e-2	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	2.5e-1	SMART
WD40	221	258	3.6e-1	SMART
Pfam:LLGL	271	372	6.2e-41	PFAM
WD40	411	451	8.8e-3	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	854	903	2e-10	BLAST

Meta Mutation Damage Score

0.2433

Coding Region Coverage

1x: 97.4%
3x: 96.7%
10x: 94.6%
20x: 90.7%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit abnormal branching morphogenesis of the placental labyrinth layer and are born as runts but catch up in size by adulthood. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003H04Rik	T	A	3: 124,556,860	D143V	unknown	Het
Abca8a	A	T	11: 110,071,451	N525K	probably damaging	Het
Abhd12	T	A	2: 150,848,418	D119V	probably damaging	Het
Adamts20	A	T	15: 94,286,344	M1526K	probably benign	Het
AI481877	T	G	4: 59,066,441	I768L	probably benign	Het
Ankdd1a	A	T	9: 65,504,489		probably null	Het
Ankrd1	C	T	19: 36,114,978	C283Y	possibly damaging	Het
Arfgef1	G	C	1: 10,204,890	I312M	probably benign	Het
Bhlhe22	G	A	3: 18,054,975	C63Y	probably damaging	Het
Bmp8a	A	T	4: 123,325,092		probably benign	Het
Ccdc148	A	T	2: 59,001,899	S235T	probably damaging	Het
Ccdc88b	G	A	19: 6,853,532	Q681*	probably null	Het
Cep104	T	A	4: 154,002,546	V842E	probably benign	Het
Chac2	T	C	11: 30,977,568	N117S	probably benign	Het
Cldn8	T	A	16: 88,562,858	I60F	probably benign	Het
Col16a1	G	A	4: 130,077,057		probably null	Het
Col4a1	A	G	8: 11,214,644		probably benign	Het
Cyp2a4	G	T	7: 26,312,210	E285D	probably damaging	Het
Cyp4a31	G	A	4: 115,569,731	G176D	probably benign	Het
Dmxl2	A	C	9: 54,460,949	Y246D	probably damaging	Het
Dync1h1	A	G	12: 110,614,059	K118R	probably damaging	Het
Eif3h	T	C	15: 51,865,436	T8A	possibly damaging	Het
Fam71d	G	A	12: 78,715,506		probably benign	Het
Fbxo18	G	T	2: 11,767,400	L157I	probably benign	Het
Fbxo40	C	A	16: 36,968,856	G631*	probably null	Het
Gabrb1	T	A	5: 72,121,938		probably null	Het
Galc	A	G	12: 98,234,240		probably null	Het
Gm10436	T	C	12: 88,178,448	E44G	possibly damaging	Het
H2-Q7	C	A	17: 35,439,699	S104R	probably benign	Het
Igkv13-54-1	A	T	6: 69,617,293	M31L	probably benign	Het
Lamc2	C	T	1: 153,166,187	R67Q	possibly damaging	Het
Lcn10	A	G	2: 25,685,139	D173G	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Lrrc66	G	A	5: 73,607,426	S758L	possibly damaging	Het
Ly6d	T	C	15: 74,762,766	K46E	probably damaging	Het
Map3k5	A	G	10: 20,099,560	N88D	probably damaging	Het
Mertk	A	T	2: 128,762,212	E422V	probably benign	Het
Mixl1	A	G	1: 180,694,731	V195A	probably benign	Het
Nmnat3	T	C	9: 98,399,468	V41A	probably damaging	Het
Olfr13	A	G	6: 43,174,900	R305G	probably benign	Het
Olfr398	A	T	11: 73,984,493	N38K	probably damaging	Het
Olfr854	A	G	9: 19,567,196	Y63H	possibly damaging	Het
Pappa2	T	A	1: 158,857,316	E751V	probably damaging	Het
Pcsk2	A	G	2: 143,793,269	S355G	probably damaging	Het
Pdzd2	A	G	15: 12,390,048	V821A	probably damaging	Het
Pifo	C	T	3: 106,014,596	E4K	possibly damaging	Het
Plxna4	A	C	6: 32,197,826	D1109E	probably benign	Het
Ppard	A	G	17: 28,297,110	M103V	probably benign	Het
Ralgapa1	T	C	12: 55,757,967	T515A	probably benign	Het
Rin2	A	G	2: 145,861,171	I596V	possibly damaging	Het
Rnls	A	G	19: 33,168,495	S75P	possibly damaging	Het
Rsph10b	A	T	5: 143,967,179	Y236F	possibly damaging	Het
Runx1t1	C	T	4: 13,835,628		probably benign	Het
Sardh	A	G	2: 27,235,569	V311A	possibly damaging	Het
Sbno2	G	T	10: 80,060,605	Y889*	probably null	Het
Sclt1	A	G	3: 41,727,111	V91A	probably damaging	Het
Sema4g	T	A	19: 44,999,017	V534E	probably benign	Het
Slc10a1	G	A	12: 80,953,672	S351F	probably benign	Het
Slc19a3	A	T	1: 83,022,747	V183E	probably damaging	Het
Slc25a12	A	G	2: 71,333,710	Y74H	possibly damaging	Het
Slc6a19	T	A	13: 73,692,950	I114L	probably benign	Het
Smpd2	A	T	10: 41,488,236	C189S	probably benign	Het
Spon1	T	A	7: 114,016,785	V295D	probably benign	Het
Tet3	A	G	6: 83,403,645	S514P	probably benign	Het
Tnk1	T	C	11: 69,856,928	I49M	probably damaging	Het
Trim80	A	G	11: 115,446,793	T431A	probably benign	Het
Vgf	A	T	5: 137,031,299	Q105L	possibly damaging	Het
Vmn1r37	G	T	6: 66,731,796	L135F	probably benign	Het
Vps37d	C	T	5: 135,073,740	A128T	possibly damaging	Het
Wdr60	T	A	12: 116,207,743	S958C	probably damaging	Het
Wwp1	T	C	4: 19,650,197	D323G	probably benign	Het
Zfp456	T	A	13: 67,367,363	I75L	probably benign	Het
Zfp990	A	G	4: 145,538,210	I593V	possibly damaging	Het

Other mutations in Llgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Llgl2	APN	11	115834884	missense	probably benign	0.00
IGL01145:Llgl2	APN	11	115853805	missense	probably benign
IGL01344:Llgl2	APN	11	115851193	missense	probably benign	0.01
IGL01980:Llgl2	APN	11	115850025	missense	probably damaging	1.00
IGL02220:Llgl2	APN	11	115845379	missense	possibly damaging	0.64
IGL02341:Llgl2	APN	11	115851120	missense	possibly damaging	0.70
IGL02399:Llgl2	APN	11	115844835	missense	probably damaging	0.97
IGL02415:Llgl2	APN	11	115853285	missense	probably damaging	0.98
IGL02632:Llgl2	APN	11	115844872	missense	probably damaging	1.00
IGL02990:Llgl2	APN	11	115854333	missense	probably benign	0.01
IGL03405:Llgl2	APN	11	115850842	missense	probably benign	0.09
R0097:Llgl2	UTSW	11	115844497	nonsense	probably null
R0166:Llgl2	UTSW	11	115844854	missense	probably damaging	1.00
R0277:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0323:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0345:Llgl2	UTSW	11	115849992	splice site	probably benign
R0614:Llgl2	UTSW	11	115850267	missense	probably damaging	1.00
R0980:Llgl2	UTSW	11	115850001	missense	probably damaging	1.00
R1387:Llgl2	UTSW	11	115853132	missense	probably damaging	0.99
R1456:Llgl2	UTSW	11	115845499	missense	probably benign	0.00
R1541:Llgl2	UTSW	11	115853121	missense	probably benign	0.00
R1950:Llgl2	UTSW	11	115851066	missense	probably damaging	0.96
R2991:Llgl2	UTSW	11	115851120	missense	probably benign	0.05
R4018:Llgl2	UTSW	11	115847612	missense	probably benign	0.31
R4582:Llgl2	UTSW	11	115850706	missense	possibly damaging	0.89
R4729:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R4907:Llgl2	UTSW	11	115853974	nonsense	probably null
R5000:Llgl2	UTSW	11	115844902	missense	probably benign
R5016:Llgl2	UTSW	11	115853424	missense	probably damaging	1.00
R5175:Llgl2	UTSW	11	115850721	missense	probably damaging	1.00
R5857:Llgl2	UTSW	11	115850281	missense	probably damaging	1.00
R6190:Llgl2	UTSW	11	115846986	missense	probably benign	0.00
R6451:Llgl2	UTSW	11	115844941	missense	probably damaging	0.99
R6804:Llgl2	UTSW	11	115843315	critical splice acceptor site	probably null
R6909:Llgl2	UTSW	11	115850799	missense	probably damaging	1.00
R7324:Llgl2	UTSW	11	115850730	missense	possibly damaging	0.49
R7332:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R7715:Llgl2	UTSW	11	115849728	missense	probably benign
R8038:Llgl2	UTSW	11	115851103	missense	probably benign	0.17
R8069:Llgl2	UTSW	11	115853286	missense	probably damaging	0.99
R8076:Llgl2	UTSW	11	115846929	missense	possibly damaging	0.69
R8109:Llgl2	UTSW	11	115850793	missense	possibly damaging	0.52
R8129:Llgl2	UTSW	11	115850911	splice site	probably null
R8731:Llgl2	UTSW	11	115851190	missense	probably benign	0.01
X0058:Llgl2	UTSW	11	115850637	missense	probably damaging	0.99
Z1176:Llgl2	UTSW	11	115849554	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGGTCTTTGTCAAGTGAGCAG -3'
(R):5'- TGGATGGAGATAGCTGAGCCAC -3'

Sequencing Primer
(F):5'- TCAAGTGAGCAGGGCATCCATC -3'
(R):5'- GATAGCTGAGCCACCAAGG -3'

Posted On

2014-06-23