Incidental Mutation 'R5013:Fam227b'
ID 390614
Institutional Source Beutler Lab
Gene Symbol Fam227b
Ensembl Gene ENSMUSG00000027209
Gene Name family with sequence similarity 227, member B
Synonyms 4930525F21Rik
MMRRC Submission 042604-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R5013 (G1)
Quality Score 160
Status Validated
Chromosome 2
Chromosomal Location 125825403-125993924 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 125958043 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 241 (P241S)
Ref Sequence ENSEMBL: ENSMUSP00000136349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
AlphaFold Q9D518
Predicted Effect probably damaging
Transcript: ENSMUST00000110446
AA Change: P241S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209
AA Change: P241S

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110448
AA Change: P241S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209
AA Change: P241S

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156413
Predicted Effect probably damaging
Transcript: ENSMUST00000178118
AA Change: P241S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209
AA Change: P241S

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Meta Mutation Damage Score 0.2711 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (86/86)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,303,926 (GRCm39) L2117P probably damaging Het
Ago3 A T 4: 126,262,391 (GRCm39) S386R probably benign Het
Agxt T C 1: 93,069,779 (GRCm39) probably benign Het
Ahctf1 A T 1: 179,611,675 (GRCm39) I565N possibly damaging Het
Ank1 C T 8: 23,572,300 (GRCm39) T70I probably damaging Het
Anxa1 A G 19: 20,360,287 (GRCm39) V108A probably benign Het
Aqp3 A G 4: 41,093,819 (GRCm39) F225L probably damaging Het
Atp11b T G 3: 35,888,532 (GRCm39) I934R possibly damaging Het
Atp13a5 A T 16: 29,169,566 (GRCm39) L42Q probably damaging Het
Bcr A G 10: 74,960,898 (GRCm39) D443G probably benign Het
Cbfa2t3 G T 8: 123,365,598 (GRCm39) D211E possibly damaging Het
Ccdc146 A T 5: 21,538,036 (GRCm39) L96Q probably damaging Het
Cdh16 A G 8: 105,343,660 (GRCm39) I612T probably damaging Het
Clcn2 G A 16: 20,525,965 (GRCm39) P785S probably damaging Het
Dennd5a A G 7: 109,513,983 (GRCm39) I743T possibly damaging Het
Dnah12 T A 14: 26,431,326 (GRCm39) D381E probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Dnajc2 G A 5: 21,962,771 (GRCm39) R521* probably null Het
Dst T C 1: 34,289,728 (GRCm39) V5776A probably damaging Het
Eddm13 G A 7: 6,269,332 (GRCm39) probably benign Het
Eif1ad19 T A 12: 87,740,512 (GRCm39) K16* probably null Het
Ercc4 G A 16: 12,941,445 (GRCm39) probably benign Het
Eya1 T A 1: 14,254,582 (GRCm39) N417Y probably damaging Het
Fam149b T A 14: 20,413,439 (GRCm39) H219Q possibly damaging Het
Fbxw17 C T 13: 50,586,506 (GRCm39) R403C probably benign Het
Fer1l4 T C 2: 155,873,135 (GRCm39) Y1315C probably damaging Het
Gatd1 G T 7: 140,988,861 (GRCm39) probably benign Het
Gm10330 A T 12: 23,829,961 (GRCm39) Y73* probably null Het
Grn C A 11: 102,321,380 (GRCm39) probably benign Het
Gsn T A 2: 35,188,933 (GRCm39) Y440N probably damaging Het
Hdc C T 2: 126,446,220 (GRCm39) E180K probably benign Het
Ilk A G 7: 105,391,456 (GRCm39) D374G probably damaging Het
Invs G A 4: 48,421,807 (GRCm39) R813Q probably damaging Het
Itln1 T A 1: 171,360,958 (GRCm39) K45* probably null Het
Ivd A G 2: 118,710,946 (GRCm39) Y385C probably damaging Het
Klk1b4 A G 7: 43,860,492 (GRCm39) N170S probably benign Het
Klk1b9 A C 7: 43,445,419 (GRCm39) D203A probably damaging Het
Lamtor3 A T 3: 137,630,909 (GRCm39) R27S probably damaging Het
Lcn6 T A 2: 25,567,082 (GRCm39) probably null Het
Lrriq1 T C 10: 103,025,784 (GRCm39) D946G probably damaging Het
Morc1 A G 16: 48,322,699 (GRCm39) D332G probably benign Het
Myo15a T C 11: 60,382,493 (GRCm39) I1523T probably damaging Het
Nagpa A T 16: 5,013,743 (GRCm39) M365K probably benign Het
Nckap5l G T 15: 99,324,457 (GRCm39) P682Q probably benign Het
Nfix A G 8: 85,498,713 (GRCm39) F87L possibly damaging Het
Nup155 C A 15: 8,153,722 (GRCm39) T421K probably benign Het
Or5ac25 A T 16: 59,182,067 (GRCm39) N171K probably damaging Het
Or5ae2 T C 7: 84,505,646 (GRCm39) V23A probably damaging Het
Or7c74 A G 2: 37,160,937 (GRCm39) noncoding transcript Het
Or8k53 A T 2: 86,177,647 (GRCm39) F154L probably benign Het
Pate14 T C 9: 36,549,120 (GRCm39) N47D probably benign Het
Pds5a A C 5: 65,792,680 (GRCm39) V751G probably benign Het
Podnl1 G T 8: 84,852,965 (GRCm39) C45F probably damaging Het
Psme2b C T 11: 48,836,654 (GRCm39) E98K probably benign Het
Ptprk T A 10: 28,427,713 (GRCm39) I764N probably damaging Het
Rbm33 A T 5: 28,547,409 (GRCm39) Q193L probably benign Het
Rnasel C A 1: 153,629,677 (GRCm39) H64Q probably damaging Het
Ryr1 G A 7: 28,802,234 (GRCm39) probably null Het
Scamp3 A G 3: 89,088,216 (GRCm39) probably benign Het
Sema6b C T 17: 56,439,497 (GRCm39) probably null Het
Six4 A C 12: 73,150,400 (GRCm39) I715R probably benign Het
Slc28a2 T C 2: 122,288,371 (GRCm39) M554T possibly damaging Het
Snhg11 T C 2: 158,218,872 (GRCm39) probably benign Het
Spdya A T 17: 71,869,499 (GRCm39) Y98F possibly damaging Het
Tert T C 13: 73,794,428 (GRCm39) probably null Het
Tex22 G A 12: 113,052,104 (GRCm39) C54Y probably damaging Het
Tmem198b C T 10: 128,637,942 (GRCm39) R207H probably damaging Het
Trbv13-1 C T 6: 41,093,189 (GRCm39) Q42* probably null Het
Trcg1 T C 9: 57,149,562 (GRCm39) L378P probably damaging Het
Trpv5 T G 6: 41,636,647 (GRCm39) D433A probably damaging Het
Ube3b A G 5: 114,545,702 (GRCm39) N654D probably damaging Het
Vmn1r17 A G 6: 57,337,828 (GRCm39) V130A probably benign Het
Vwa7 A T 17: 35,241,709 (GRCm39) Y448F probably damaging Het
Zan A C 5: 137,382,099 (GRCm39) D5149E unknown Het
Zfp106 A G 2: 120,341,015 (GRCm39) W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 (GRCm39) G514S probably damaging Het
Zhx1 G A 15: 57,917,538 (GRCm39) T236I possibly damaging Het
Other mutations in Fam227b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Fam227b APN 2 125,986,245 (GRCm39) critical splice acceptor site probably null
IGL00970:Fam227b APN 2 125,968,980 (GRCm39) missense probably benign 0.01
IGL02040:Fam227b APN 2 125,963,004 (GRCm39) splice site probably benign
IGL02095:Fam227b APN 2 125,942,924 (GRCm39) missense probably damaging 0.97
IGL02352:Fam227b APN 2 125,988,174 (GRCm39) unclassified probably benign
IGL02359:Fam227b APN 2 125,988,174 (GRCm39) unclassified probably benign
IGL02506:Fam227b APN 2 125,845,831 (GRCm39) missense probably benign 0.22
IGL02717:Fam227b APN 2 125,845,763 (GRCm39) missense probably null 0.97
IGL02933:Fam227b APN 2 125,965,908 (GRCm39) splice site probably null
IGL03064:Fam227b APN 2 125,968,762 (GRCm39) splice site probably null
IGL03086:Fam227b APN 2 125,960,951 (GRCm39) missense probably benign 0.01
IGL03198:Fam227b APN 2 125,966,499 (GRCm39) critical splice donor site probably null
IGL03256:Fam227b APN 2 125,830,923 (GRCm39) missense probably damaging 0.99
IGL03368:Fam227b APN 2 125,960,983 (GRCm39) missense probably damaging 1.00
dana UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R0071:Fam227b UTSW 2 125,965,994 (GRCm39) missense probably benign 0.04
R0071:Fam227b UTSW 2 125,965,994 (GRCm39) missense probably benign 0.04
R0110:Fam227b UTSW 2 125,942,841 (GRCm39) missense probably damaging 1.00
R0140:Fam227b UTSW 2 125,966,523 (GRCm39) missense possibly damaging 0.53
R0377:Fam227b UTSW 2 125,966,920 (GRCm39) splice site probably benign
R0499:Fam227b UTSW 2 125,942,829 (GRCm39) missense probably benign 0.25
R1240:Fam227b UTSW 2 125,966,505 (GRCm39) missense possibly damaging 0.56
R1356:Fam227b UTSW 2 125,960,928 (GRCm39) missense probably damaging 1.00
R1404:Fam227b UTSW 2 125,845,759 (GRCm39) missense probably damaging 0.99
R1404:Fam227b UTSW 2 125,845,759 (GRCm39) missense probably damaging 0.99
R2055:Fam227b UTSW 2 125,942,874 (GRCm39) missense probably benign 0.13
R2884:Fam227b UTSW 2 125,942,846 (GRCm39) missense probably benign 0.01
R3124:Fam227b UTSW 2 125,966,006 (GRCm39) missense probably benign 0.36
R3125:Fam227b UTSW 2 125,966,006 (GRCm39) missense probably benign 0.36
R3937:Fam227b UTSW 2 125,968,980 (GRCm39) missense probably benign 0.01
R4408:Fam227b UTSW 2 125,958,045 (GRCm39) missense possibly damaging 0.47
R4454:Fam227b UTSW 2 125,988,188 (GRCm39) unclassified probably benign
R4455:Fam227b UTSW 2 125,988,188 (GRCm39) unclassified probably benign
R4457:Fam227b UTSW 2 125,988,188 (GRCm39) unclassified probably benign
R4558:Fam227b UTSW 2 125,968,963 (GRCm39) missense probably benign 0.00
R4661:Fam227b UTSW 2 125,849,230 (GRCm39) missense probably damaging 0.99
R4809:Fam227b UTSW 2 125,958,045 (GRCm39) missense possibly damaging 0.47
R4810:Fam227b UTSW 2 125,829,859 (GRCm39) missense probably benign 0.01
R4989:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5011:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5014:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5133:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5184:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5431:Fam227b UTSW 2 125,968,851 (GRCm39) missense probably benign 0.09
R5797:Fam227b UTSW 2 125,849,254 (GRCm39) missense probably benign
R6056:Fam227b UTSW 2 125,962,972 (GRCm39) missense probably damaging 1.00
R6218:Fam227b UTSW 2 125,968,882 (GRCm39) missense probably damaging 1.00
R6471:Fam227b UTSW 2 125,962,985 (GRCm39) missense probably damaging 1.00
R6660:Fam227b UTSW 2 125,986,227 (GRCm39) missense probably damaging 1.00
R6734:Fam227b UTSW 2 125,968,896 (GRCm39) nonsense probably null
R7136:Fam227b UTSW 2 125,965,948 (GRCm39) missense probably damaging 0.99
R7410:Fam227b UTSW 2 125,960,983 (GRCm39) missense probably damaging 1.00
R8417:Fam227b UTSW 2 125,962,982 (GRCm39) missense probably damaging 1.00
R8679:Fam227b UTSW 2 125,830,928 (GRCm39) missense probably benign 0.02
R8731:Fam227b UTSW 2 125,968,898 (GRCm39) missense possibly damaging 0.95
R8986:Fam227b UTSW 2 125,958,019 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATGTTTTGGTTGGAGCAAATACTC -3'
(R):5'- AGTGCTACCAGATAGACTCAGTTTG -3'

Sequencing Primer
(F):5'- ATCGTGTTTCCTAGGTCTTC -3'
(R):5'- TTTGCTCATGTTCCTCAATTAGAG -3'
Posted On 2016-06-06