Incidental Mutation 'R5103:Dlx6'
ID392478
Institutional Source Beutler Lab
Gene Symbol Dlx6
Ensembl Gene ENSMUSG00000029754
Gene Namedistal-less homeobox 6
Synonyms
MMRRC Submission 042691-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5103 (G1)
Quality Score217
Status Validated
Chromosome6
Chromosomal Location6863334-6868568 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGG to AG at 6865180 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031768] [ENSMUST00000160937] [ENSMUST00000171311]
Predicted Effect probably null
Transcript: ENSMUST00000031768
SMART Domains Protein: ENSMUSP00000031768
Gene: ENSMUSG00000029754

DomainStartEndE-ValueType
HOX 32 94 7.65e-23 SMART
low complexity region 102 118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159827
Predicted Effect probably null
Transcript: ENSMUST00000160937
SMART Domains Protein: ENSMUSP00000124204
Gene: ENSMUSG00000029754

DomainStartEndE-ValueType
low complexity region 26 59 N/A INTRINSIC
low complexity region 79 102 N/A INTRINSIC
HOX 171 233 7.65e-23 SMART
low complexity region 241 257 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171311
SMART Domains Protein: ENSMUSP00000128585
Gene: ENSMUSG00000029754

DomainStartEndE-ValueType
low complexity region 26 59 N/A INTRINSIC
low complexity region 79 102 N/A INTRINSIC
HOX 171 233 7.65e-23 SMART
low complexity region 241 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178206
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. This family is comprised of at least 6 different members that encode proteins with roles in forebrain and craniofacial development. This gene is in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations at both Dlx5 and Dlx6 exhibit bilateral ectrodactyly, homeotic transformation of the lower jaw into an upper jaw, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,189,262 I591V probably benign Het
Agbl5 G A 5: 30,894,001 R518H probably damaging Het
Agfg1 T C 1: 82,893,567 S486P probably damaging Het
Arhgap18 A G 10: 26,869,982 D283G probably damaging Het
Asb1 A G 1: 91,552,344 N162S possibly damaging Het
BC037034 A G 5: 138,262,300 V288A probably benign Het
Capn1 A G 19: 6,009,110 Y274H probably damaging Het
Cdk5 A T 5: 24,422,835 V30E probably damaging Het
Cep290 T G 10: 100,539,020 L1376W probably damaging Het
Crybg1 T A 10: 43,997,948 T1055S probably damaging Het
Cyp2c70 A G 19: 40,160,632 Y357H probably damaging Het
Eml6 T A 11: 29,850,905 E367V possibly damaging Het
Emp1 A G 6: 135,381,075 T140A probably benign Het
Ergic3 T C 2: 156,008,625 V74A probably benign Het
Fancm A T 12: 65,105,858 L1029F probably damaging Het
Fank1 C A 7: 133,876,841 C210* probably null Het
Fbxo31 T C 8: 121,552,362 D462G probably damaging Het
Frem1 G A 4: 82,991,612 A736V probably benign Het
Fshr T C 17: 89,097,368 T56A possibly damaging Het
Gm5901 A T 7: 105,377,382 probably null Het
Gm8909 T C 17: 36,161,685 probably benign Het
Golga2 A G 2: 32,303,746 E458G probably benign Het
Grik2 T A 10: 49,496,109 I335F probably benign Het
Grin1 T A 2: 25,310,421 M230L probably benign Het
Gtf2f1 C T 17: 57,004,519 G297D probably damaging Het
Hacd1 T C 2: 14,040,913 T136A probably damaging Het
Hdac5 T A 11: 102,196,283 S24C probably damaging Het
Jtb T C 3: 90,232,087 probably benign Het
Kif1a C T 1: 93,046,696 G979E probably damaging Het
Mark2 T C 19: 7,284,503 M345V probably damaging Het
Mfsd14b A G 13: 65,087,093 V90A possibly damaging Het
Micu1 T C 10: 59,788,984 Y283H possibly damaging Het
Mmp2 C T 8: 92,831,785 R161* probably null Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Msh5 T C 17: 35,029,239 I783V possibly damaging Het
Myo3b T A 2: 70,096,403 F65I probably benign Het
Nat10 C A 2: 103,757,260 V37L probably damaging Het
Nlrp1a T A 11: 71,099,526 T967S probably damaging Het
Nolc1 A T 19: 46,081,664 K291* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr347 A T 2: 36,734,668 T116S probably benign Het
Olfr52 C A 2: 86,181,616 R165L probably benign Het
Olfr926 G T 9: 38,877,576 M133I probably damaging Het
Paip1 A G 13: 119,437,979 E70G possibly damaging Het
Palmd T A 3: 116,927,421 E127V probably damaging Het
Paqr6 T A 3: 88,367,717 C262* probably null Het
Pdcd11 A G 19: 47,124,454 H1301R probably benign Het
Plce1 C A 19: 38,767,215 D1896E probably damaging Het
Ppib A G 9: 66,061,465 probably null Het
Pzp C T 6: 128,502,229 V654M probably benign Het
Rab26 T C 17: 24,534,097 probably benign Het
Recql4 A G 15: 76,706,756 L468P probably damaging Het
Retreg1 C T 15: 25,968,454 Q65* probably null Het
Rhpn1 C T 15: 75,714,215 T659I possibly damaging Het
Slc12a5 C A 2: 164,992,433 H791Q probably damaging Het
Slc40a1 G A 1: 45,918,995 Q93* probably null Het
Slc4a1 T C 11: 102,353,261 M681V possibly damaging Het
Slc6a9 T A 4: 117,868,155 F493L probably benign Het
Smc2 A G 4: 52,459,033 E476G probably damaging Het
Smco4 G T 9: 15,544,794 E59* probably null Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stat4 T A 1: 52,071,895 L167Q probably damaging Het
Sult1e1 C A 5: 87,576,232 V289L probably benign Het
Tbc1d4 C A 14: 101,458,882 E877* probably null Het
Tenm4 A T 7: 96,842,957 I1033F probably damaging Het
Tppp2 T A 14: 51,919,452 F95L probably benign Het
Vmn2r41 G A 7: 8,138,342 L708F probably benign Het
Washc5 G A 15: 59,350,169 P126L probably damaging Het
Xkr4 T C 1: 3,670,688 I221V probably benign Het
Xkr5 T C 8: 18,933,643 R628G probably benign Het
Zfp207 T C 11: 80,391,910 L233P probably damaging Het
Zfp827 T A 8: 79,070,403 C373S probably damaging Het
Other mutations in Dlx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Dlx6 APN 6 6865143 missense probably damaging 1.00
IGL01081:Dlx6 APN 6 6867068 missense probably damaging 1.00
IGL03034:Dlx6 APN 6 6863807 missense probably benign 0.45
IGL03309:Dlx6 APN 6 6867289 missense possibly damaging 0.77
R0848:Dlx6 UTSW 6 6863665 nonsense probably null
R1004:Dlx6 UTSW 6 6863665 nonsense probably null
R1694:Dlx6 UTSW 6 6867173 missense probably damaging 1.00
R1753:Dlx6 UTSW 6 6863665 nonsense probably null
R2076:Dlx6 UTSW 6 6867098 missense probably benign 0.00
R2293:Dlx6 UTSW 6 6867246 missense probably damaging 1.00
R4488:Dlx6 UTSW 6 6867207 missense probably damaging 0.99
R4574:Dlx6 UTSW 6 6865305 intron probably benign
R4942:Dlx6 UTSW 6 6863468 missense probably benign 0.28
R5102:Dlx6 UTSW 6 6865180 frame shift probably null
R5104:Dlx6 UTSW 6 6865180 frame shift probably null
R5105:Dlx6 UTSW 6 6865180 frame shift probably null
R5736:Dlx6 UTSW 6 6863660 missense probably damaging 0.97
R7577:Dlx6 UTSW 6 6863423 missense probably damaging 1.00
R7995:Dlx6 UTSW 6 6867277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAGCCTTGTCACATGAAG -3'
(R):5'- CACGGGCATTTGTCATTTAGC -3'

Sequencing Primer
(F):5'- CTTGTCACATGAAGGGAGAAGGC -3'
(R):5'- GGTTGACTAGGCCAAGAATTCCTC -3'
Posted On2016-06-15