Incidental Mutation 'R5115:Asic1'
ID394164
Institutional Source Beutler Lab
Gene Symbol Asic1
Ensembl Gene ENSMUSG00000023017
Gene Nameacid-sensing (proton-gated) ion channel 1
SynonymsASIC1a, ASICalpha, B530003N02Rik, ASIC, Accn2, BNaC2, ASIC1 beta
MMRRC Submission 042703-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R5115 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99670368-99701130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99672052 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 85 (L85F)
Ref Sequence ENSEMBL: ENSMUSP00000023758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023758]
Predicted Effect probably damaging
Transcript: ENSMUST00000023758
AA Change: L85F

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023758
Gene: ENSMUSG00000023017
AA Change: L85F

DomainStartEndE-ValueType
Pfam:ASC 21 454 9.9e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228012
Meta Mutation Damage Score 0.4237 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acid-sensing ion channel (ASIC) family of proteins, which are part of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. Members of the ASIC family are sensitive to amiloride and function in neurotransmission. The encoded proteins function in learning, pain transduction, touch sensation, and development of memory and fear. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in absence of H+-gated currents in hippocampal neurons, impaired long term potentiation, reduced excitatory postsynaptic potentials, and defective spatial learning and eye blink conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 C T 11: 54,340,498 probably null Het
Atic G A 1: 71,557,275 probably null Het
Atp1b2 T C 11: 69,603,473 T65A probably damaging Het
C2cd6 T A 1: 59,051,261 I446L probably benign Het
Cep83 A G 10: 94,768,889 H488R probably benign Het
Cwc15 A G 9: 14,507,896 I163V probably benign Het
Cyp11b2 A T 15: 74,855,428 probably null Het
Fat2 A G 11: 55,296,333 V1229A probably damaging Het
Fbn1 T C 2: 125,332,383 D1851G probably damaging Het
Golga7 A T 8: 23,245,970 probably null Het
Gsdmc2 A T 15: 63,827,768 H270Q probably benign Het
Kdm4a G T 4: 118,162,581 P326Q possibly damaging Het
Kng1 G A 16: 23,069,282 R209H possibly damaging Het
Mfn1 T C 3: 32,564,307 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Nlrc5 G A 8: 94,476,819 V516I possibly damaging Het
Nrbp1 T G 5: 31,243,715 Y96* probably null Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pikfyve T C 1: 65,224,117 probably benign Het
Plin1 AGGCCACCAGGGGGTGGGC AGGC 7: 79,729,944 probably benign Het
Prkdc A G 16: 15,790,580 Q3082R probably benign Het
Rbfox1 A G 16: 7,409,772 S405G probably damaging Het
Recql T C 6: 142,358,559 probably benign Het
Serpina3c T C 12: 104,147,392 E365G probably damaging Het
Slc17a5 A G 9: 78,577,112 V122A probably benign Het
Sprr2b G T 3: 92,317,555 C36F unknown Het
Stk36 T C 1: 74,635,827 I1307T probably damaging Het
Tmc6 G A 11: 117,775,188 T300I probably damaging Het
Ttll9 C A 2: 152,989,590 probably benign Het
Vmn1r71 T A 7: 10,747,958 M202L probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Asic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01418:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01718:Asic1 APN 15 99672002 missense probably damaging 1.00
IGL01941:Asic1 APN 15 99699101 missense possibly damaging 0.95
IGL01993:Asic1 APN 15 99697472 missense probably benign 0.01
IGL02097:Asic1 APN 15 99694686 splice site probably benign
IGL03028:Asic1 APN 15 99672157 missense probably benign 0.03
IGL03082:Asic1 APN 15 99696547 missense probably benign
IGL03183:Asic1 APN 15 99672017 missense probably benign 0.43
IGL03231:Asic1 APN 15 99699102 missense probably benign 0.42
R0111:Asic1 UTSW 15 99696983 missense probably damaging 1.00
R0243:Asic1 UTSW 15 99698617 unclassified probably benign
R0316:Asic1 UTSW 15 99671938 missense probably benign 0.03
R0518:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0520:Asic1 UTSW 15 99695535 missense probably damaging 1.00
R0521:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0610:Asic1 UTSW 15 99698899 missense probably benign 0.14
R1034:Asic1 UTSW 15 99698058 missense probably damaging 1.00
R1666:Asic1 UTSW 15 99699125 missense probably damaging 1.00
R1796:Asic1 UTSW 15 99696654 missense probably null 0.99
R1993:Asic1 UTSW 15 99671884 missense probably damaging 1.00
R2130:Asic1 UTSW 15 99671875 missense possibly damaging 0.73
R2180:Asic1 UTSW 15 99671965 missense probably benign
R2895:Asic1 UTSW 15 99696602 missense probably benign 0.22
R3793:Asic1 UTSW 15 99672025 nonsense probably null
R3848:Asic1 UTSW 15 99672933 missense probably benign 0.01
R5186:Asic1 UTSW 15 99698803 unclassified probably benign
R5187:Asic1 UTSW 15 99698803 unclassified probably benign
R5409:Asic1 UTSW 15 99698803 unclassified probably benign
R6011:Asic1 UTSW 15 99699079 missense probably benign 0.05
R6383:Asic1 UTSW 15 99698880 missense probably damaging 0.96
R7133:Asic1 UTSW 15 99672087 missense probably damaging 1.00
R7255:Asic1 UTSW 15 99697457 missense probably damaging 0.97
R7587:Asic1 UTSW 15 99695590 missense probably damaging 1.00
R8012:Asic1 UTSW 15 99696651 missense possibly damaging 0.92
R8030:Asic1 UTSW 15 99694841 missense possibly damaging 0.56
R8089:Asic1 UTSW 15 99698087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGCATCCAGGCTTTTGC -3'
(R):5'- CTAGAGGGCAGAGCTGTTTGAC -3'

Sequencing Primer
(F):5'- TTTGCCAGCAGCTCCACG -3'
(R):5'- ACTTTTGGTGGGCTAAGGAC -3'
Posted On2016-06-15