Incidental Mutation 'R5154:Grk3'
ID396571
Institutional Source Beutler Lab
Gene Symbol Grk3
Ensembl Gene ENSMUSG00000042249
Gene NameG protein-coupled receptor kinase 3
Synonyms4833444A01Rik, Bark-2, Adrbk-2, Adrbk2, beta ARK2
MMRRC Submission 042736-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5154 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location112910482-113015791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112941717 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 281 (I281N)
Ref Sequence ENSEMBL: ENSMUSP00000142968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065167] [ENSMUST00000197888] [ENSMUST00000200332]
Predicted Effect probably damaging
Transcript: ENSMUST00000065167
AA Change: I323N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070445
Gene: ENSMUSG00000042249
AA Change: I323N

DomainStartEndE-ValueType
RGS 54 175 1.44e-28 SMART
S_TKc 191 453 8.94e-85 SMART
S_TK_X 454 530 2.19e-10 SMART
PH 559 654 8.45e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197888
AA Change: I281N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142968
Gene: ENSMUSG00000042249
AA Change: I281N

DomainStartEndE-ValueType
RGS 12 133 1.44e-28 SMART
S_TKc 149 411 8.94e-85 SMART
S_TK_X 412 488 2.19e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200332
SMART Domains Protein: ENSMUSP00000142926
Gene: ENSMUSG00000042249

DomainStartEndE-ValueType
PDB:3V5W|A 1 88 6e-42 PDB
SCOP:d1dk8a_ 48 88 2e-4 SMART
Blast:RGS 54 88 1e-18 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The beta-adrenergic receptor kinase specifically phosphorylates the agonist-occupied form of the beta-adrenergic and related G protein-coupled receptors. Overall, the beta adrenergic receptor kinase 2 has 85% amino acid similarity with beta adrenergic receptor kinase 1, with the protein kinase catalytic domain having 95% similarity. These data suggest the existence of a family of receptor kinases which may serve broadly to regulate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation of this gene appear normal and are fertile, but exhibit a lack of odorant receptor-mediated desensitization in the olfactory epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A C 4: 39,450,938 H48P probably damaging Het
Angptl7 C T 4: 148,497,425 R168H probably damaging Het
Ankrd11 A C 8: 122,893,139 F1325V probably damaging Het
Ankrd13c A G 3: 157,988,660 D266G possibly damaging Het
Apold1 A T 6: 134,983,673 H30L possibly damaging Het
Arel1 A G 12: 84,931,773 F362L probably benign Het
Arhgef4 T A 1: 34,732,374 M1254K probably benign Het
Arid2 T A 15: 96,401,985 V1793E probably damaging Het
Bcl7a T C 5: 123,369,359 S156P probably damaging Het
Cbr3 A G 16: 93,685,139 I128V probably benign Het
Cct6b G A 11: 82,739,695 P299L probably damaging Het
Cd180 A T 13: 102,705,774 N443Y probably damaging Het
Cd80 A G 16: 38,473,980 K75R probably benign Het
Cdk1 A T 10: 69,340,468 probably benign Het
Cep192 T A 18: 67,850,684 F1565I probably damaging Het
Chtf18 T C 17: 25,723,720 T412A probably damaging Het
Cit T C 5: 115,988,405 L1590P probably damaging Het
Clcn2 T A 16: 20,703,303 R845S probably benign Het
Cndp2 C T 18: 84,668,602 V432I probably benign Het
Cnnm2 A T 19: 46,763,132 R454W probably benign Het
Cpne8 T G 15: 90,499,918 I480L probably benign Het
Cr2 A G 1: 195,159,446 W400R probably damaging Het
Cul5 A G 9: 53,625,867 L528P probably damaging Het
Dlgap5 C T 14: 47,413,720 V119M probably damaging Het
Dnah12 T C 14: 26,849,363 S190P probably benign Het
Dnah3 T A 7: 119,952,419 K2881N probably damaging Het
Dnmt3a A T 12: 3,896,008 I288F probably damaging Het
Dse T A 10: 34,153,661 T478S possibly damaging Het
Edn1 C T 13: 42,305,023 T104I probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eprs A G 1: 185,413,465 H1157R probably damaging Het
Fam168b G A 1: 34,818,099 T179I possibly damaging Het
Fzd5 A G 1: 64,735,972 V210A probably benign Het
Gm9742 T C 13: 8,035,045 noncoding transcript Het
Gpc1 G A 1: 92,857,029 G308D probably damaging Het
Gpr141 C T 13: 19,752,242 R121K probably benign Het
Greb1l A G 18: 10,458,312 T30A probably benign Het
Hnrnpdl A T 5: 100,036,512 Y289* probably null Het
Hsf2 T G 10: 57,504,712 V214G probably benign Het
Igf2bp1 G A 11: 95,963,547 Q563* probably null Het
Il31ra T A 13: 112,523,997 D605V possibly damaging Het
Insm2 G A 12: 55,600,197 C242Y probably damaging Het
Ints3 C T 3: 90,415,561 V121I probably benign Het
Kcnt2 A T 1: 140,351,256 L48F possibly damaging Het
Kit G A 5: 75,640,540 V529M probably damaging Het
Mark2 G A 19: 7,283,074 P13S probably damaging Het
Mthfsd A G 8: 121,098,740 V364A probably damaging Het
Mtmr11 C G 3: 96,164,319 S185R probably benign Het
Myot A G 18: 44,354,214 I373V probably benign Het
N4bp3 A T 11: 51,645,312 V231D probably benign Het
Olfr1089 A T 2: 86,732,777 Y278* probably null Het
Olfr1102 T C 2: 87,002,038 V23A probably benign Het
Pdcd6ip A G 9: 113,691,542 F125L probably damaging Het
Prpf39 A T 12: 65,048,277 Q124L probably benign Het
Reln A T 5: 21,988,765 N1398K probably damaging Het
Rhod A T 19: 4,432,094 D97E probably damaging Het
Rxra T C 2: 27,757,868 probably null Het
Slc1a3 T C 15: 8,642,949 I349V probably benign Het
Slc37a2 A T 9: 37,231,643 *502R probably null Het
Slc9b1 T C 3: 135,373,179 I199T probably damaging Het
Spg20 C T 3: 55,117,329 P115L probably damaging Het
Tnpo1 A T 13: 98,870,305 C205S possibly damaging Het
Tubb1 T A 2: 174,456,864 I113N probably benign Het
Tyrp1 G A 4: 80,850,717 V483I probably benign Het
Vwde T C 6: 13,215,758 S100G probably benign Het
Zfhx3 A T 8: 108,800,575 I1035F probably damaging Het
Zfp618 G T 4: 63,133,209 K742N probably damaging Het
Zfp873 T C 10: 82,060,191 V252A possibly damaging Het
Other mutations in Grk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Grk3 APN 5 112985819 missense probably damaging 1.00
IGL01359:Grk3 APN 5 112937760 missense probably damaging 1.00
IGL02318:Grk3 APN 5 112937803 missense probably damaging 1.00
IGL02612:Grk3 APN 5 112969234 missense probably benign 0.27
R0142:Grk3 UTSW 5 112915053 missense probably damaging 1.00
R0589:Grk3 UTSW 5 112928763 splice site probably benign
R0607:Grk3 UTSW 5 112920053 missense probably damaging 1.00
R1459:Grk3 UTSW 5 112915012 missense probably benign 0.10
R1554:Grk3 UTSW 5 112969269 missense possibly damaging 0.76
R1640:Grk3 UTSW 5 113015382 missense probably benign 0.36
R1657:Grk3 UTSW 5 112966982 missense probably damaging 1.00
R1789:Grk3 UTSW 5 112941718 missense probably damaging 1.00
R2401:Grk3 UTSW 5 112914983 missense probably benign
R3735:Grk3 UTSW 5 112953831 missense probably benign 0.00
R4024:Grk3 UTSW 5 112914984 missense possibly damaging 0.77
R4025:Grk3 UTSW 5 112914984 missense possibly damaging 0.77
R4392:Grk3 UTSW 5 112920136 missense probably damaging 1.00
R4439:Grk3 UTSW 5 112946677 splice site probably null
R4589:Grk3 UTSW 5 112941718 missense possibly damaging 0.87
R4646:Grk3 UTSW 5 112929720 missense probably benign 0.04
R5462:Grk3 UTSW 5 112969208 missense probably damaging 1.00
R5764:Grk3 UTSW 5 112966910 critical splice donor site probably null
R5790:Grk3 UTSW 5 112966976 missense possibly damaging 0.80
R6516:Grk3 UTSW 5 112961549 intron probably benign
R6848:Grk3 UTSW 5 112985775 missense probably damaging 0.98
RF021:Grk3 UTSW 5 112941688 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACAGAACATCCCAGCTGGTG -3'
(R):5'- TTCAAGCCTGTGGTGGGAAC -3'

Sequencing Primer
(F):5'- ATCCCAGCTGGTGAGGGAG -3'
(R):5'- AGGTCACTCTCAGAGTCCC -3'
Posted On2016-06-21