Mutagenetix > Incidental Mutations

Incidental Mutation 'R5154:Grk3'

396571

Institutional Source

Beutler Lab

Gene Symbol

Grk3

Ensembl Gene

ENSMUSG00000042249

Gene Name

G protein-coupled receptor kinase 3

Synonyms

4833444A01Rik, Bark-2, Adrbk-2, Adrbk2, beta ARK2

MMRRC Submission

042736-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5154 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

112910482-113015791 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 112941717 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 281 (I281N)

Ref Sequence

ENSEMBL: ENSMUSP00000142968 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065167] [ENSMUST00000197888] [ENSMUST00000200332]

Predicted Effect

probably damaging
Transcript: ENSMUST00000065167
AA Change: I323N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000070445
Gene: ENSMUSG00000042249
AA Change: I323N

Domain	Start	End	E-Value	Type
RGS	54	175	1.44e-28	SMART
S_TKc	191	453	8.94e-85	SMART
S_TK_X	454	530	2.19e-10	SMART
PH	559	654	8.45e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000197888
AA Change: I281N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142968
Gene: ENSMUSG00000042249
AA Change: I281N

Domain	Start	End	E-Value	Type
RGS	12	133	1.44e-28	SMART
S_TKc	149	411	8.94e-85	SMART
S_TK_X	412	488	2.19e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200332

SMART Domains

Protein: ENSMUSP00000142926
Gene: ENSMUSG00000042249

Domain	Start	End	E-Value	Type
PDB:3V5W\|A	1	88	6e-42	PDB
SCOP:d1dk8a_	48	88	2e-4	SMART
Blast:RGS	54	88	1e-18	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The beta-adrenergic receptor kinase specifically phosphorylates the agonist-occupied form of the beta-adrenergic and related G protein-coupled receptors. Overall, the beta adrenergic receptor kinase 2 has 85% amino acid similarity with beta adrenergic receptor kinase 1, with the protein kinase catalytic domain having 95% similarity. These data suggest the existence of a family of receptor kinases which may serve broadly to regulate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation of this gene appear normal and are fertile, but exhibit a lack of odorant receptor-mediated desensitization in the olfactory epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	C	4: 39,450,938	H48P	probably damaging	Het
Angptl7	C	T	4: 148,497,425	R168H	probably damaging	Het
Ankrd11	A	C	8: 122,893,139	F1325V	probably damaging	Het
Ankrd13c	A	G	3: 157,988,660	D266G	possibly damaging	Het
Apold1	A	T	6: 134,983,673	H30L	possibly damaging	Het
Arel1	A	G	12: 84,931,773	F362L	probably benign	Het
Arhgef4	T	A	1: 34,732,374	M1254K	probably benign	Het
Arid2	T	A	15: 96,401,985	V1793E	probably damaging	Het
Bcl7a	T	C	5: 123,369,359	S156P	probably damaging	Het
Cbr3	A	G	16: 93,685,139	I128V	probably benign	Het
Cct6b	G	A	11: 82,739,695	P299L	probably damaging	Het
Cd180	A	T	13: 102,705,774	N443Y	probably damaging	Het
Cd80	A	G	16: 38,473,980	K75R	probably benign	Het
Cdk1	A	T	10: 69,340,468		probably benign	Het
Cep192	T	A	18: 67,850,684	F1565I	probably damaging	Het
Chtf18	T	C	17: 25,723,720	T412A	probably damaging	Het
Cit	T	C	5: 115,988,405	L1590P	probably damaging	Het
Clcn2	T	A	16: 20,703,303	R845S	probably benign	Het
Cndp2	C	T	18: 84,668,602	V432I	probably benign	Het
Cnnm2	A	T	19: 46,763,132	R454W	probably benign	Het
Cpne8	T	G	15: 90,499,918	I480L	probably benign	Het
Cr2	A	G	1: 195,159,446	W400R	probably damaging	Het
Cul5	A	G	9: 53,625,867	L528P	probably damaging	Het
Dlgap5	C	T	14: 47,413,720	V119M	probably damaging	Het
Dnah12	T	C	14: 26,849,363	S190P	probably benign	Het
Dnah3	T	A	7: 119,952,419	K2881N	probably damaging	Het
Dnmt3a	A	T	12: 3,896,008	I288F	probably damaging	Het
Dse	T	A	10: 34,153,661	T478S	possibly damaging	Het
Edn1	C	T	13: 42,305,023	T104I	probably benign	Het
Eef2	GCCC	GCCCC	10: 81,178,767		probably null	Het
Eprs	A	G	1: 185,413,465	H1157R	probably damaging	Het
Fam168b	G	A	1: 34,818,099	T179I	possibly damaging	Het
Fzd5	A	G	1: 64,735,972	V210A	probably benign	Het
Gm9742	T	C	13: 8,035,045		noncoding transcript	Het
Gpc1	G	A	1: 92,857,029	G308D	probably damaging	Het
Gpr141	C	T	13: 19,752,242	R121K	probably benign	Het
Greb1l	A	G	18: 10,458,312	T30A	probably benign	Het
Hnrnpdl	A	T	5: 100,036,512	Y289*	probably null	Het
Hsf2	T	G	10: 57,504,712	V214G	probably benign	Het
Igf2bp1	G	A	11: 95,963,547	Q563*	probably null	Het
Il31ra	T	A	13: 112,523,997	D605V	possibly damaging	Het
Insm2	G	A	12: 55,600,197	C242Y	probably damaging	Het
Ints3	C	T	3: 90,415,561	V121I	probably benign	Het
Kcnt2	A	T	1: 140,351,256	L48F	possibly damaging	Het
Kit	G	A	5: 75,640,540	V529M	probably damaging	Het
Mark2	G	A	19: 7,283,074	P13S	probably damaging	Het
Mthfsd	A	G	8: 121,098,740	V364A	probably damaging	Het
Mtmr11	C	G	3: 96,164,319	S185R	probably benign	Het
Myot	A	G	18: 44,354,214	I373V	probably benign	Het
N4bp3	A	T	11: 51,645,312	V231D	probably benign	Het
Olfr1089	A	T	2: 86,732,777	Y278*	probably null	Het
Olfr1102	T	C	2: 87,002,038	V23A	probably benign	Het
Pdcd6ip	A	G	9: 113,691,542	F125L	probably damaging	Het
Prpf39	A	T	12: 65,048,277	Q124L	probably benign	Het
Reln	A	T	5: 21,988,765	N1398K	probably damaging	Het
Rhod	A	T	19: 4,432,094	D97E	probably damaging	Het
Rxra	T	C	2: 27,757,868		probably null	Het
Slc1a3	T	C	15: 8,642,949	I349V	probably benign	Het
Slc37a2	A	T	9: 37,231,643	*502R	probably null	Het
Slc9b1	T	C	3: 135,373,179	I199T	probably damaging	Het
Spg20	C	T	3: 55,117,329	P115L	probably damaging	Het
Tnpo1	A	T	13: 98,870,305	C205S	possibly damaging	Het
Tubb1	T	A	2: 174,456,864	I113N	probably benign	Het
Tyrp1	G	A	4: 80,850,717	V483I	probably benign	Het
Vwde	T	C	6: 13,215,758	S100G	probably benign	Het
Zfhx3	A	T	8: 108,800,575	I1035F	probably damaging	Het
Zfp618	G	T	4: 63,133,209	K742N	probably damaging	Het
Zfp873	T	C	10: 82,060,191	V252A	possibly damaging	Het

Other mutations in Grk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00974:Grk3	APN	5	112985819	missense	probably damaging	1.00
IGL01359:Grk3	APN	5	112937760	missense	probably damaging	1.00
IGL02318:Grk3	APN	5	112937803	missense	probably damaging	1.00
IGL02612:Grk3	APN	5	112969234	missense	probably benign	0.27
R0142:Grk3	UTSW	5	112915053	missense	probably damaging	1.00
R0589:Grk3	UTSW	5	112928763	splice site	probably benign
R0607:Grk3	UTSW	5	112920053	missense	probably damaging	1.00
R1459:Grk3	UTSW	5	112915012	missense	probably benign	0.10
R1554:Grk3	UTSW	5	112969269	missense	possibly damaging	0.76
R1640:Grk3	UTSW	5	113015382	missense	probably benign	0.36
R1657:Grk3	UTSW	5	112966982	missense	probably damaging	1.00
R1789:Grk3	UTSW	5	112941718	missense	probably damaging	1.00
R2401:Grk3	UTSW	5	112914983	missense	probably benign
R3735:Grk3	UTSW	5	112953831	missense	probably benign	0.00
R4024:Grk3	UTSW	5	112914984	missense	possibly damaging	0.77
R4025:Grk3	UTSW	5	112914984	missense	possibly damaging	0.77
R4392:Grk3	UTSW	5	112920136	missense	probably damaging	1.00
R4439:Grk3	UTSW	5	112946677	splice site	probably null
R4589:Grk3	UTSW	5	112941718	missense	possibly damaging	0.87
R4646:Grk3	UTSW	5	112929720	missense	probably benign	0.04
R5462:Grk3	UTSW	5	112969208	missense	probably damaging	1.00
R5764:Grk3	UTSW	5	112966910	critical splice donor site	probably null
R5790:Grk3	UTSW	5	112966976	missense	possibly damaging	0.80
R6516:Grk3	UTSW	5	112961549	intron	probably benign
R6848:Grk3	UTSW	5	112985775	missense	probably damaging	0.98
R7857:Grk3	UTSW	5	112961561	missense	unknown
R7873:Grk3	UTSW	5	112929686	missense	probably benign	0.03
R8029:Grk3	UTSW	5	112961642	missense	probably benign
R8132:Grk3	UTSW	5	112961489	missense	unknown
RF021:Grk3	UTSW	5	112941688	missense	probably benign	0.20
Z1176:Grk3	UTSW	5	112957314	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGAACATCCCAGCTGGTG -3'
(R):5'- TTCAAGCCTGTGGTGGGAAC -3'

Sequencing Primer
(F):5'- ATCCCAGCTGGTGAGGGAG -3'
(R):5'- AGGTCACTCTCAGAGTCCC -3'

Posted On

2016-06-21