Incidental Mutation 'R5462:Grk3'
ID433063
Institutional Source Beutler Lab
Gene Symbol Grk3
Ensembl Gene ENSMUSG00000042249
Gene NameG protein-coupled receptor kinase 3
Synonyms4833444A01Rik, Bark-2, Adrbk-2, Adrbk2, beta ARK2
MMRRC Submission 043024-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5462 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location112910482-113015791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112969208 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 67 (Y67C)
Ref Sequence ENSEMBL: ENSMUSP00000142968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065167] [ENSMUST00000197776] [ENSMUST00000197888] [ENSMUST00000200332]
Predicted Effect probably damaging
Transcript: ENSMUST00000065167
AA Change: Y109C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070445
Gene: ENSMUSG00000042249
AA Change: Y109C

DomainStartEndE-ValueType
RGS 54 175 1.44e-28 SMART
S_TKc 191 453 8.94e-85 SMART
S_TK_X 454 530 2.19e-10 SMART
PH 559 654 8.45e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197776
AA Change: Y109C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143427
Gene: ENSMUSG00000042249
AA Change: Y109C

DomainStartEndE-ValueType
RGS 54 170 7.71e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197888
AA Change: Y67C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142968
Gene: ENSMUSG00000042249
AA Change: Y67C

DomainStartEndE-ValueType
RGS 12 133 1.44e-28 SMART
S_TKc 149 411 8.94e-85 SMART
S_TK_X 412 488 2.19e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200332
SMART Domains Protein: ENSMUSP00000142926
Gene: ENSMUSG00000042249

DomainStartEndE-ValueType
PDB:3V5W|A 1 88 6e-42 PDB
SCOP:d1dk8a_ 48 88 2e-4 SMART
Blast:RGS 54 88 1e-18 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The beta-adrenergic receptor kinase specifically phosphorylates the agonist-occupied form of the beta-adrenergic and related G protein-coupled receptors. Overall, the beta adrenergic receptor kinase 2 has 85% amino acid similarity with beta adrenergic receptor kinase 1, with the protein kinase catalytic domain having 95% similarity. These data suggest the existence of a family of receptor kinases which may serve broadly to regulate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation of this gene appear normal and are fertile, but exhibit a lack of odorant receptor-mediated desensitization in the olfactory epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
4933412E24Rik A G 15: 60,015,068 F508L probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Amz1 A G 5: 140,748,221 Y184C probably damaging Het
Calm3 A T 7: 16,917,694 D23E possibly damaging Het
Cep112 T A 11: 108,518,744 N479K probably damaging Het
Csmd1 A C 8: 15,961,486 N2522K probably benign Het
D3Ertd254e C T 3: 36,165,820 T664I possibly damaging Het
Dhx30 A G 9: 110,100,974 L18P probably damaging Het
E2f2 A T 4: 136,172,913 T45S probably benign Het
Htt T A 5: 34,885,507 C2290* probably null Het
Igsf10 T C 3: 59,325,754 T1853A probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Mast2 A G 4: 116,307,458 L1587P probably damaging Het
Mdn1 A G 4: 32,720,897 N2337D probably benign Het
Mettl3 T C 14: 52,299,879 Q182R probably damaging Het
Mterf1b A G 5: 4,196,541 S61G probably benign Het
Mycbp2 T C 14: 103,200,126 Y2100C probably damaging Het
Nt5m T A 11: 59,874,559 W138R probably damaging Het
Olfr998 A G 2: 85,591,296 Y252C probably damaging Het
Prex1 A G 2: 166,644,808 Y114H probably benign Het
Rasa2 A T 9: 96,571,918 S322T probably damaging Het
Sis A T 3: 72,949,838 D373E probably damaging Het
Snx29 A T 16: 11,511,012 M552L possibly damaging Het
Sptbn1 G T 11: 30,100,520 F2356L possibly damaging Het
Tbc1d10c G T 19: 4,188,053 Q241K probably benign Het
Vmn1r222 A G 13: 23,232,875 I56T probably benign Het
Vmn2r111 T C 17: 22,548,257 Y753C probably damaging Het
Vmn2r37 A G 7: 9,217,974 W297R probably damaging Het
Wdr66 T C 5: 123,298,632 probably null Het
Zfp651 G T 9: 121,767,663 R695L probably damaging Het
Other mutations in Grk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Grk3 APN 5 112985819 missense probably damaging 1.00
IGL01359:Grk3 APN 5 112937760 missense probably damaging 1.00
IGL02318:Grk3 APN 5 112937803 missense probably damaging 1.00
IGL02612:Grk3 APN 5 112969234 missense probably benign 0.27
R0142:Grk3 UTSW 5 112915053 missense probably damaging 1.00
R0589:Grk3 UTSW 5 112928763 splice site probably benign
R0607:Grk3 UTSW 5 112920053 missense probably damaging 1.00
R1459:Grk3 UTSW 5 112915012 missense probably benign 0.10
R1554:Grk3 UTSW 5 112969269 missense possibly damaging 0.76
R1640:Grk3 UTSW 5 113015382 missense probably benign 0.36
R1657:Grk3 UTSW 5 112966982 missense probably damaging 1.00
R1789:Grk3 UTSW 5 112941718 missense probably damaging 1.00
R2401:Grk3 UTSW 5 112914983 missense probably benign
R3735:Grk3 UTSW 5 112953831 missense probably benign 0.00
R4024:Grk3 UTSW 5 112914984 missense possibly damaging 0.77
R4025:Grk3 UTSW 5 112914984 missense possibly damaging 0.77
R4392:Grk3 UTSW 5 112920136 missense probably damaging 1.00
R4439:Grk3 UTSW 5 112946677 splice site probably null
R4589:Grk3 UTSW 5 112941718 missense possibly damaging 0.87
R4646:Grk3 UTSW 5 112929720 missense probably benign 0.04
R5154:Grk3 UTSW 5 112941717 missense probably damaging 1.00
R5764:Grk3 UTSW 5 112966910 critical splice donor site probably null
R5790:Grk3 UTSW 5 112966976 missense possibly damaging 0.80
R6516:Grk3 UTSW 5 112961549 intron probably benign
R6848:Grk3 UTSW 5 112985775 missense probably damaging 0.98
R7857:Grk3 UTSW 5 112961561 missense unknown
R7873:Grk3 UTSW 5 112929686 missense probably benign 0.03
R8029:Grk3 UTSW 5 112961642 missense probably benign
R8132:Grk3 UTSW 5 112961489 missense unknown
R8903:Grk3 UTSW 5 112918831 missense possibly damaging 0.89
RF021:Grk3 UTSW 5 112941688 missense probably benign 0.20
Z1176:Grk3 UTSW 5 112957314 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTCTGATTCACCCAATTGCTAAAG -3'
(R):5'- CATCGCTGCCTCAGTAATTTG -3'

Sequencing Primer
(F):5'- AAGGCCCTGGGTTCAATTCTAGAC -3'
(R):5'- GCCTCAGTAATTTGTTTTATCTCGTG -3'
Posted On2016-10-06