Incidental Mutation 'R6848:Grk3'
ID534855
Institutional Source Beutler Lab
Gene Symbol Grk3
Ensembl Gene ENSMUSG00000042249
Gene NameG protein-coupled receptor kinase 3
Synonyms4833444A01Rik, Bark-2, Adrbk-2, Adrbk2, beta ARK2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6848 (G1)
Quality Score111.008
Status Not validated
Chromosome5
Chromosomal Location112910482-113015791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 112985775 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 60 (N60K)
Ref Sequence ENSEMBL: ENSMUSP00000143427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065167] [ENSMUST00000197776] [ENSMUST00000197888] [ENSMUST00000200332]
Predicted Effect probably benign
Transcript: ENSMUST00000065167
AA Change: N60K

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000070445
Gene: ENSMUSG00000042249
AA Change: N60K

DomainStartEndE-ValueType
RGS 54 175 1.44e-28 SMART
S_TKc 191 453 8.94e-85 SMART
S_TK_X 454 530 2.19e-10 SMART
PH 559 654 8.45e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197776
AA Change: N60K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143427
Gene: ENSMUSG00000042249
AA Change: N60K

DomainStartEndE-ValueType
RGS 54 170 7.71e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197888
AA Change: N18K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000142968
Gene: ENSMUSG00000042249
AA Change: N18K

DomainStartEndE-ValueType
RGS 12 133 1.44e-28 SMART
S_TKc 149 411 8.94e-85 SMART
S_TK_X 412 488 2.19e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200332
AA Change: N60K

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142926
Gene: ENSMUSG00000042249
AA Change: N60K

DomainStartEndE-ValueType
PDB:3V5W|A 1 88 6e-42 PDB
SCOP:d1dk8a_ 48 88 2e-4 SMART
Blast:RGS 54 88 1e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The beta-adrenergic receptor kinase specifically phosphorylates the agonist-occupied form of the beta-adrenergic and related G protein-coupled receptors. Overall, the beta adrenergic receptor kinase 2 has 85% amino acid similarity with beta adrenergic receptor kinase 1, with the protein kinase catalytic domain having 95% similarity. These data suggest the existence of a family of receptor kinases which may serve broadly to regulate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation of this gene appear normal and are fertile, but exhibit a lack of odorant receptor-mediated desensitization in the olfactory epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Grk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Grk3 APN 5 112985819 missense probably damaging 1.00
IGL01359:Grk3 APN 5 112937760 missense probably damaging 1.00
IGL02318:Grk3 APN 5 112937803 missense probably damaging 1.00
IGL02612:Grk3 APN 5 112969234 missense probably benign 0.27
R0142:Grk3 UTSW 5 112915053 missense probably damaging 1.00
R0589:Grk3 UTSW 5 112928763 splice site probably benign
R0607:Grk3 UTSW 5 112920053 missense probably damaging 1.00
R1459:Grk3 UTSW 5 112915012 missense probably benign 0.10
R1554:Grk3 UTSW 5 112969269 missense possibly damaging 0.76
R1640:Grk3 UTSW 5 113015382 missense probably benign 0.36
R1657:Grk3 UTSW 5 112966982 missense probably damaging 1.00
R1789:Grk3 UTSW 5 112941718 missense probably damaging 1.00
R2401:Grk3 UTSW 5 112914983 missense probably benign
R3735:Grk3 UTSW 5 112953831 missense probably benign 0.00
R4024:Grk3 UTSW 5 112914984 missense possibly damaging 0.77
R4025:Grk3 UTSW 5 112914984 missense possibly damaging 0.77
R4392:Grk3 UTSW 5 112920136 missense probably damaging 1.00
R4439:Grk3 UTSW 5 112946677 splice site probably null
R4589:Grk3 UTSW 5 112941718 missense possibly damaging 0.87
R4646:Grk3 UTSW 5 112929720 missense probably benign 0.04
R5154:Grk3 UTSW 5 112941717 missense probably damaging 1.00
R5462:Grk3 UTSW 5 112969208 missense probably damaging 1.00
R5764:Grk3 UTSW 5 112966910 critical splice donor site probably null
R5790:Grk3 UTSW 5 112966976 missense possibly damaging 0.80
R6516:Grk3 UTSW 5 112961549 intron probably benign
R7857:Grk3 UTSW 5 112961561 missense unknown
R7873:Grk3 UTSW 5 112929686 missense probably benign 0.03
R7940:Grk3 UTSW 5 112961561 missense unknown
R7956:Grk3 UTSW 5 112929686 missense probably benign 0.03
R8029:Grk3 UTSW 5 112961642 missense probably benign
R8132:Grk3 UTSW 5 112961489 missense unknown
RF021:Grk3 UTSW 5 112941688 missense probably benign 0.20
Z1176:Grk3 UTSW 5 112957314 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAAGGTATTGACTACAGGAGAACATTC -3'
(R):5'- AGGACATTCTCTGGCTTCCC -3'

Sequencing Primer
(F):5'- CCCTCAATATCATTAACTGTGAGGG -3'
(R):5'- CCAATCAGGGACTCAAGCTGG -3'
Posted On2018-09-12