Incidental Mutation 'R5157:Zfp672'
ID 396790
Institutional Source Beutler Lab
Gene Symbol Zfp672
Ensembl Gene ENSMUSG00000049755
Gene Name zinc finger protein 672
Synonyms 4930511N19Rik, 4930488P06Rik
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R5157 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 58315114-58330339 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58316851 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 215 (S215P)
Ref Sequence ENSEMBL: ENSMUSP00000104457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049353] [ENSMUST00000057836] [ENSMUST00000064786] [ENSMUST00000108829] [ENSMUST00000153510] [ENSMUST00000155662] [ENSMUST00000186859]
AlphaFold Q99LH4
Predicted Effect probably benign
Transcript: ENSMUST00000049353
SMART Domains Protein: ENSMUSP00000131896
Gene: ENSMUSG00000037243

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
low complexity region 159 175 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
ZnF_C2H2 327 352 4.11e-2 SMART
ZnF_C2H2 358 382 2.05e-2 SMART
ZnF_C2H2 388 410 1.69e-3 SMART
ZnF_C2H2 416 438 1.69e-3 SMART
ZnF_C2H2 447 470 6.23e-2 SMART
low complexity region 502 520 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000057836
AA Change: S215P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000060088
Gene: ENSMUSG00000049755
AA Change: S215P

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
ZnF_C2H2 43 65 8.75e0 SMART
ZnF_C2H2 71 93 1.18e-2 SMART
ZnF_C2H2 100 123 1.76e-1 SMART
ZnF_C2H2 129 151 1.59e1 SMART
ZnF_C2H2 167 189 4.47e-3 SMART
ZnF_C2H2 202 224 9.58e-3 SMART
ZnF_C2H2 230 252 7.37e-4 SMART
ZnF_C2H2 258 280 3.16e-3 SMART
ZnF_C2H2 286 308 1.45e-2 SMART
ZnF_C2H2 314 336 4.01e-5 SMART
ZnF_C2H2 342 364 5.5e-3 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
ZnF_C2H2 398 420 6.67e-2 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000064786
AA Change: S215P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070567
Gene: ENSMUSG00000049755
AA Change: S215P

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
ZnF_C2H2 43 65 8.75e0 SMART
ZnF_C2H2 71 93 1.18e-2 SMART
ZnF_C2H2 100 123 1.76e-1 SMART
ZnF_C2H2 129 151 1.59e1 SMART
ZnF_C2H2 167 189 4.47e-3 SMART
ZnF_C2H2 202 224 9.58e-3 SMART
ZnF_C2H2 230 252 7.37e-4 SMART
ZnF_C2H2 258 280 3.16e-3 SMART
ZnF_C2H2 286 308 1.45e-2 SMART
ZnF_C2H2 314 336 4.01e-5 SMART
ZnF_C2H2 342 364 5.5e-3 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
ZnF_C2H2 398 420 6.67e-2 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108829
AA Change: S215P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104457
Gene: ENSMUSG00000049755
AA Change: S215P

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
ZnF_C2H2 43 65 8.75e0 SMART
ZnF_C2H2 71 93 1.18e-2 SMART
ZnF_C2H2 100 123 1.76e-1 SMART
ZnF_C2H2 129 151 1.59e1 SMART
ZnF_C2H2 167 189 4.47e-3 SMART
ZnF_C2H2 202 224 9.58e-3 SMART
ZnF_C2H2 230 252 7.37e-4 SMART
ZnF_C2H2 258 280 3.16e-3 SMART
ZnF_C2H2 286 308 1.45e-2 SMART
ZnF_C2H2 314 336 4.01e-5 SMART
ZnF_C2H2 342 364 5.5e-3 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
ZnF_C2H2 398 420 6.67e-2 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135097
Predicted Effect probably benign
Transcript: ENSMUST00000153510
SMART Domains Protein: ENSMUSP00000126674
Gene: ENSMUSG00000037243

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
low complexity region 159 175 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
ZnF_C2H2 327 352 4.11e-2 SMART
ZnF_C2H2 358 382 2.05e-2 SMART
ZnF_C2H2 388 410 1.69e-3 SMART
ZnF_C2H2 416 438 1.69e-3 SMART
ZnF_C2H2 447 470 6.23e-2 SMART
low complexity region 502 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155662
SMART Domains Protein: ENSMUSP00000114561
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186859
SMART Domains Protein: ENSMUSP00000140236
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 1.8e-5 SMART
ZnF_C2H2 43 65 3.6e-2 SMART
ZnF_C2H2 71 90 6.1e-1 SMART
Meta Mutation Damage Score 0.4743 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Zfp672
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Zfp672 APN 11 58317366 missense probably damaging 1.00
R0326:Zfp672 UTSW 11 58316347 missense possibly damaging 0.86
R1485:Zfp672 UTSW 11 58329569 intron probably benign
R1664:Zfp672 UTSW 11 58317312 missense probably damaging 0.99
R1667:Zfp672 UTSW 11 58316095 missense possibly damaging 0.53
R1853:Zfp672 UTSW 11 58316964 missense probably benign
R2074:Zfp672 UTSW 11 58316636 missense possibly damaging 0.71
R3817:Zfp672 UTSW 11 58316636 missense possibly damaging 0.71
R4623:Zfp672 UTSW 11 58316455 missense probably benign 0.34
R4745:Zfp672 UTSW 11 58329498 intron probably benign
R5240:Zfp672 UTSW 11 58329701 intron probably benign
R5510:Zfp672 UTSW 11 58316630 nonsense probably null
R6207:Zfp672 UTSW 11 58317523 start gained probably benign
R6279:Zfp672 UTSW 11 58317268 missense probably damaging 0.99
R6300:Zfp672 UTSW 11 58317268 missense probably damaging 0.99
R6432:Zfp672 UTSW 11 58316932 missense possibly damaging 0.53
R6438:Zfp672 UTSW 11 58316737 missense probably benign 0.07
R7777:Zfp672 UTSW 11 58317255 missense possibly damaging 0.71
R8401:Zfp672 UTSW 11 58316802 missense probably benign 0.28
R8489:Zfp672 UTSW 11 58329855 intron probably benign
R8826:Zfp672 UTSW 11 58329764 missense unknown
R8858:Zfp672 UTSW 11 58317319 missense possibly damaging 0.91
R9298:Zfp672 UTSW 11 58329764 missense unknown
RF012:Zfp672 UTSW 11 58316112 missense probably benign
Z1186:Zfp672 UTSW 11 58329626 missense unknown
Z1186:Zfp672 UTSW 11 58329960 intron probably benign
Z1187:Zfp672 UTSW 11 58329626 missense unknown
Z1188:Zfp672 UTSW 11 58329626 missense unknown
Z1189:Zfp672 UTSW 11 58329626 missense unknown
Z1190:Zfp672 UTSW 11 58329626 missense unknown
Z1191:Zfp672 UTSW 11 58329626 missense unknown
Z1191:Zfp672 UTSW 11 58329960 intron probably benign
Z1192:Zfp672 UTSW 11 58329626 missense unknown
Predicted Primers PCR Primer
(F):5'- AAAGCCCTTGCCACAAGTG -3'
(R):5'- GAGATCATCACTGTCACCGC -3'

Sequencing Primer
(F):5'- TTCACCCTGATGGCTGCG -3'
(R):5'- ATCACTGTCACCGCCCCTTC -3'
Posted On 2016-06-21