Incidental Mutation 'R5157:Kcnf1'
ID396794
Institutional Source Beutler Lab
Gene Symbol Kcnf1
Ensembl Gene ENSMUSG00000051726
Gene Namepotassium voltage-gated channel, subfamily F, member 1
SynonymsLOC382571
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R5157 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location17172100-17176888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17174741 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 493 (E493G)
Ref Sequence ENSEMBL: ENSMUSP00000131480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170580]
Predicted Effect probably benign
Transcript: ENSMUST00000170580
AA Change: E493G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131480
Gene: ENSMUSG00000051726
AA Change: E493G

DomainStartEndE-ValueType
BTB 33 147 2.32e-2 SMART
Pfam:Ion_trans 193 429 1.3e-49 PFAM
Pfam:Ion_trans_2 337 423 3.4e-14 PFAM
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily F. This gene is intronless and expressed in all tissues tested, including the heart, skeletal muscle, brain, kidney, and pancreas. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Kcnf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Kcnf1 APN 12 17175348 missense probably benign 0.00
IGL02586:Kcnf1 APN 12 17176143 missense probably benign 0.27
R0931:Kcnf1 UTSW 12 17175141 missense possibly damaging 0.89
R1068:Kcnf1 UTSW 12 17175474 missense probably damaging 1.00
R1558:Kcnf1 UTSW 12 17175473 missense probably damaging 1.00
R1571:Kcnf1 UTSW 12 17175852 missense probably benign 0.00
R1607:Kcnf1 UTSW 12 17175732 missense probably benign 0.26
R2471:Kcnf1 UTSW 12 17175530 missense probably damaging 1.00
R4013:Kcnf1 UTSW 12 17175993 missense probably benign 0.01
R4095:Kcnf1 UTSW 12 17175479 missense possibly damaging 0.92
R4980:Kcnf1 UTSW 12 17175011 missense possibly damaging 0.88
R6017:Kcnf1 UTSW 12 17175081 missense probably damaging 0.97
R7130:Kcnf1 UTSW 12 17175809 missense probably benign 0.27
R7225:Kcnf1 UTSW 12 17175693 missense possibly damaging 0.47
R7308:Kcnf1 UTSW 12 17174729 missense probably benign 0.13
R7614:Kcnf1 UTSW 12 17174786 missense probably benign 0.03
R7624:Kcnf1 UTSW 12 17176136 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAAGGAGTCTTACCCAGTCTTG -3'
(R):5'- TACAACAAACAACGTGTCCTGG -3'

Sequencing Primer
(F):5'- TTACCCAGTCTTGGCAAAGG -3'
(R):5'- GACGGCAGCCAAGCATG -3'
Posted On2016-06-21