Incidental Mutation 'R5172:Mdc1'
ID398857
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Namemediator of DNA damage checkpoint 1
SynonymsNFBD1
MMRRC Submission 042752-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R5172 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35841515-35859670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35853090 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1177 (S1177P)
Ref Sequence ENSEMBL: ENSMUSP00000080949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082337]
Predicted Effect probably benign
Transcript: ENSMUST00000082337
AA Change: S1177P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607
AA Change: S1177P

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225192
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,375,608 Y52C probably damaging Het
Acmsd C T 1: 127,753,848 R183* probably null Het
Anxa2 T A 9: 69,485,251 D127E probably damaging Het
Atrnl1 T A 19: 57,685,513 Y593* probably null Het
Atxn2 C T 5: 121,795,035 probably null Het
Ccl6 A T 11: 83,589,343 Y66N probably damaging Het
Ccng1 A G 11: 40,751,286 V223A probably benign Het
Cfap44 T C 16: 44,449,193 Y1187H probably benign Het
Cfc1 A T 1: 34,535,930 I10F probably benign Het
Chrne T A 11: 70,615,526 T365S probably benign Het
Clec4b1 G T 6: 123,071,455 R183L probably benign Het
Csmd2 A C 4: 128,477,397 Q1926P probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dzip1 T A 14: 118,887,151 Q570L probably damaging Het
Fam149a T A 8: 45,344,653 Q507L probably damaging Het
Frem3 T C 8: 80,612,566 V496A probably benign Het
Fryl A T 5: 73,101,673 D589E possibly damaging Het
Hemk1 T C 9: 107,329,432 E4G possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnh7 T C 2: 62,739,164 D796G possibly damaging Het
Lemd2 G T 17: 27,195,382 S326* probably null Het
Mfsd4b4 A G 10: 39,894,087 F78S probably damaging Het
Mmgt2 T A 11: 62,665,128 F101I possibly damaging Het
Myo18a T C 11: 77,824,098 L785P probably damaging Het
Nup155 C A 15: 8,109,542 Q33K probably benign Het
Olfr1152 A G 2: 87,868,827 T279A probably benign Het
Olfr584 T C 7: 103,085,677 L48P probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank1 A T 19: 34,840,802 C112* probably null Het
Pcmtd1 T A 1: 7,163,261 M23K probably benign Het
Rere A T 4: 150,570,269 R419S unknown Het
Rpf1 T C 3: 146,512,295 R155G possibly damaging Het
Sema7a A G 9: 57,957,678 T421A probably benign Het
Sharpin A G 15: 76,347,541 S323P probably benign Het
Slamf6 A G 1: 171,936,580 E180G probably benign Het
Snd1 T G 6: 28,886,616 V874G possibly damaging Het
Sult6b2 A T 6: 142,797,931 V123D probably damaging Het
Tpk1 A T 6: 43,560,017 probably null Het
Vmn1r160 A T 7: 22,871,336 N38I probably damaging Het
Wdr93 T A 7: 79,752,493 I180N probably damaging Het
Ythdf3 C T 3: 16,204,034 T119I probably damaging Het
Zc3h18 T G 8: 122,407,420 probably benign Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 35848020 missense probably benign 0.04
IGL01662:Mdc1 APN 17 35852505 missense probably benign 0.00
IGL01931:Mdc1 APN 17 35848231 missense probably benign 0.00
IGL02542:Mdc1 APN 17 35853156 missense probably damaging 0.96
IGL02823:Mdc1 APN 17 35852923 missense probably damaging 0.99
IGL03411:Mdc1 APN 17 35853126 missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 35846191 missense possibly damaging 0.86
PIT4362001:Mdc1 UTSW 17 35844469 missense possibly damaging 0.72
R0054:Mdc1 UTSW 17 35849033 missense probably benign 0.00
R0129:Mdc1 UTSW 17 35854445 missense probably benign 0.04
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0132:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1597:Mdc1 UTSW 17 35845866 missense probably damaging 1.00
R1721:Mdc1 UTSW 17 35847826 missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1912:Mdc1 UTSW 17 35844538 missense probably benign 0.00
R1912:Mdc1 UTSW 17 35850811 missense probably benign 0.19
R1977:Mdc1 UTSW 17 35850930 missense probably benign 0.01
R2121:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2122:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2357:Mdc1 UTSW 17 35847445 missense probably benign 0.00
R2842:Mdc1 UTSW 17 35848794 missense probably benign 0.01
R2851:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2852:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2964:Mdc1 UTSW 17 35853637 missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 35847893 unclassified probably benign
R3752:Mdc1 UTSW 17 35845929 missense probably damaging 1.00
R4234:Mdc1 UTSW 17 35848824 missense probably benign 0.00
R4641:Mdc1 UTSW 17 35857469 missense probably benign 0.09
R4706:Mdc1 UTSW 17 35852779 missense probably damaging 0.99
R4809:Mdc1 UTSW 17 35849101 critical splice donor site probably null
R4833:Mdc1 UTSW 17 35850394 missense probably benign 0.20
R5032:Mdc1 UTSW 17 35850589 missense probably benign 0.00
R5047:Mdc1 UTSW 17 35847844 missense probably benign 0.00
R5086:Mdc1 UTSW 17 35848630 missense probably benign 0.00
R5254:Mdc1 UTSW 17 35847922 missense probably benign 0.00
R5473:Mdc1 UTSW 17 35848060 missense probably benign 0.01
R5550:Mdc1 UTSW 17 35845884 missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 35848546 missense probably benign 0.00
R5888:Mdc1 UTSW 17 35847820 missense probably benign 0.01
R6020:Mdc1 UTSW 17 35848633 missense probably benign 0.04
R6020:Mdc1 UTSW 17 35857572 missense probably benign 0.01
R6219:Mdc1 UTSW 17 35850674 missense probably benign 0.10
R7053:Mdc1 UTSW 17 35846326 missense probably benign 0.00
R7073:Mdc1 UTSW 17 35854068 missense probably benign 0.18
R7077:Mdc1 UTSW 17 35845947 missense probably damaging 0.97
R7424:Mdc1 UTSW 17 35853309 missense probably benign 0.04
R7443:Mdc1 UTSW 17 35850820 missense probably damaging 0.98
R7467:Mdc1 UTSW 17 35844556 missense probably benign 0.29
R7549:Mdc1 UTSW 17 35848857 missense probably null 0.04
R7655:Mdc1 UTSW 17 35850881 missense probably benign 0.01
R7656:Mdc1 UTSW 17 35850881 missense probably benign 0.01
RF025:Mdc1 UTSW 17 35854407 critical splice acceptor site probably benign
X0022:Mdc1 UTSW 17 35850937 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAACAGTCTGTCACCCCAG -3'
(R):5'- CTTACTTGATCTACCCCGAGAG -3'

Sequencing Primer
(F):5'- AGACCGCAAACCTCGGG -3'
(R):5'- GCCCGAGATGTGAGGTTAG -3'
Posted On2016-07-06