Incidental Mutation 'R5240:Olfr495'
ID400723
Institutional Source Beutler Lab
Gene Symbol Olfr495
Ensembl Gene ENSMUSG00000110253
Gene Nameolfactory receptor 495
SynonymsMOR204-37, GA_x6K02T2PBJ9-10725148-10726140
MMRRC Submission 042811-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R5240 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108393167-108397513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108395702 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 194 (D194V)
Ref Sequence ENSEMBL: ENSMUSP00000150689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000210990] [ENSMUST00000215215]
Predicted Effect probably damaging
Transcript: ENSMUST00000071505
AA Change: D194V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071440
Gene: ENSMUSG00000094104
AA Change: D194V

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 3.6e-51 PFAM
Pfam:7tm_1 44 293 2.7e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210990
AA Change: D194V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215215
AA Change: D194V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.3623 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdc42bpg T G 19: 6,315,899 L786R probably damaging Het
Cfap73 C T 5: 120,629,707 V260I probably damaging Het
Chchd10 A T 10: 75,937,449 N131I probably damaging Het
Chn2 T C 6: 54,220,695 V190A probably benign Het
Clec2l C T 6: 38,673,452 T64I probably damaging Het
Cpeb3 T A 19: 37,174,515 T154S probably damaging Het
D130043K22Rik A G 13: 24,877,977 E643G probably damaging Het
Ddx31 A G 2: 28,846,030 M127V probably benign Het
Dennd1b A G 1: 139,062,877 Y193C probably damaging Het
Dgke T A 11: 89,050,685 D288V probably damaging Het
Dst T A 1: 34,208,558 L1683* probably null Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
E130116L18Rik G T 5: 25,223,020 probably benign Het
Eif2b5 G A 16: 20,501,398 V115I possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fgfr3 A T 5: 33,730,038 T234S probably damaging Het
Gipc2 A T 3: 152,102,662 D251E possibly damaging Het
Gm11787 A C 4: 3,511,810 noncoding transcript Het
Gm5538 A C 3: 59,752,028 T301P probably damaging Het
Haus6 A G 4: 86,583,178 Y819H possibly damaging Het
Homez G A 14: 54,858,074 A59V probably damaging Het
Iffo1 T C 6: 125,152,460 V363A probably benign Het
Ifit2 T A 19: 34,574,396 D445E probably benign Het
Ipo9 A C 1: 135,389,606 probably benign Het
Kcnv1 C T 15: 45,113,244 G216R probably damaging Het
Kdm6b A C 11: 69,401,904 probably benign Het
Mplkip T C 13: 17,695,719 S79P probably damaging Het
Nae1 T C 8: 104,523,144 probably benign Het
Nfe2l2 A T 2: 75,676,009 N582K possibly damaging Het
Nsmce4a G A 7: 130,537,024 R297C probably damaging Het
Olfr397 T C 11: 73,964,806 L66P probably damaging Het
Olfr411 T A 11: 74,347,242 D114V probably damaging Het
Osbp T A 19: 11,978,290 F357I probably damaging Het
Pcdhb4 A G 18: 37,309,926 D763G possibly damaging Het
Pcdhgb2 A C 18: 37,691,050 I365L possibly damaging Het
Pde6g A G 11: 120,448,086 probably benign Het
Pigo C A 4: 43,020,675 V756L possibly damaging Het
Pkhd1 G T 1: 20,275,641 T2721K probably benign Het
Pls1 A T 9: 95,776,622 probably null Het
Prim2 A G 1: 33,480,316 probably benign Het
Prkd2 T A 7: 16,855,786 I471N probably benign Het
Prrc2b C T 2: 32,206,396 T593I probably benign Het
Ptch2 C A 4: 117,106,138 probably benign Het
Pth A T 7: 113,385,844 D107E probably damaging Het
Pycr2 A C 1: 180,907,623 Q315P probably benign Het
Rbpj A T 5: 53,649,440 Y209F probably damaging Het
Ripk4 C A 16: 97,743,767 R560L probably damaging Het
Sdr42e1 T C 8: 117,663,282 R207G probably benign Het
Sipa1l1 A G 12: 82,341,588 Y196C possibly damaging Het
Smarcc2 T C 10: 128,481,006 probably null Het
Stom T A 2: 35,336,877 I15F probably benign Het
Sugp2 G T 8: 70,243,275 L299F probably benign Het
Tbrg4 A T 11: 6,617,516 probably null Het
Tkt G T 14: 30,565,678 G210C probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Trip12 A G 1: 84,794,133 I98T probably benign Het
Unc5b A G 10: 60,774,640 I466T probably damaging Het
Unc79 T A 12: 103,070,751 F599L probably damaging Het
Vav1 G A 17: 57,297,122 E151K probably damaging Het
Vcan T G 13: 89,692,532 D1631A probably benign Het
Vmn2r4 A C 3: 64,406,937 S208A possibly damaging Het
Zfp619 A G 7: 39,537,218 T891A possibly damaging Het
Zfp672 A G 11: 58,329,701 probably benign Het
Znhit1 T A 5: 136,982,381 probably null Het
Other mutations in Olfr495
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Olfr495 APN 7 108395245 missense probably benign 0.31
IGL02430:Olfr495 APN 7 108395722 missense probably benign 0.01
IGL02511:Olfr495 APN 7 108396058 missense probably benign 0.06
IGL02932:Olfr495 APN 7 108395513 missense probably benign 0.03
IGL03222:Olfr495 APN 7 108395186 missense possibly damaging 0.77
FR4340:Olfr495 UTSW 7 108395893 missense probably benign
FR4340:Olfr495 UTSW 7 108395898 missense probably benign
FR4342:Olfr495 UTSW 7 108395893 missense probably benign
FR4342:Olfr495 UTSW 7 108395898 missense probably benign
R0141:Olfr495 UTSW 7 108395368 missense probably benign 0.06
R0600:Olfr495 UTSW 7 108395231 missense probably damaging 0.98
R0635:Olfr495 UTSW 7 108395764 missense probably benign 0.01
R0685:Olfr495 UTSW 7 108395263 missense possibly damaging 0.67
R1220:Olfr495 UTSW 7 108395332 missense probably benign 0.03
R1398:Olfr495 UTSW 7 108395501 missense probably damaging 0.98
R1501:Olfr495 UTSW 7 108396082 missense probably benign 0.00
R1990:Olfr495 UTSW 7 108395834 missense probably benign 0.00
R2091:Olfr495 UTSW 7 108395861 missense probably damaging 1.00
R2473:Olfr495 UTSW 7 108395504 missense probably damaging 1.00
R3120:Olfr495 UTSW 7 108395723 missense possibly damaging 0.67
R4771:Olfr495 UTSW 7 108396022 nonsense probably null
R5510:Olfr495 UTSW 7 108395125 missense probably benign 0.01
R5703:Olfr495 UTSW 7 108395500 missense probably benign 0.23
R6102:Olfr495 UTSW 7 108395284 missense probably damaging 0.99
R6110:Olfr495 UTSW 7 108395828 missense possibly damaging 0.93
R6782:Olfr495 UTSW 7 108395537 missense probably damaging 1.00
R7062:Olfr495 UTSW 7 108395830 nonsense probably null
R7783:Olfr495 UTSW 7 108396089 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CCAAAATGTCCAGAGAAGCCTG -3'
(R):5'- CAACACCTTGTTCTGGTCAGTG -3'

Sequencing Primer
(F):5'- TCCAGAGAAGCCTGTATCCAGTTG -3'
(R):5'- CTGGACTTGGGCATCACATAAATG -3'
Posted On2016-07-06