Incidental Mutation 'R0416:F10'
ID40321
Institutional Source Beutler Lab
Gene Symbol F10
Ensembl Gene ENSMUSG00000031444
Gene Namecoagulation factor X
SynonymsAI194738, Cf10, fX
MMRRC Submission 038618-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0416 (G1)
Quality Score106
Status Validated
Chromosome8
Chromosomal Location13037308-13056676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13055448 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 338 (A338T)
Ref Sequence ENSEMBL: ENSMUSP00000068389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033821] [ENSMUST00000063820] [ENSMUST00000128418] [ENSMUST00000152034]
Predicted Effect probably damaging
Transcript: ENSMUST00000033821
AA Change: A350T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033821
Gene: ENSMUSG00000031444
AA Change: A350T

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
GLA 34 97 5.98e-32 SMART
EGF_CA 98 134 4.56e-9 SMART
EGF 140 177 2.66e-1 SMART
low complexity region 201 218 N/A INTRINSIC
Tryp_SPc 243 471 9.03e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063820
AA Change: A338T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068389
Gene: ENSMUSG00000031444
AA Change: A338T

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Tryp_SPc 231 459 9.03e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128418
SMART Domains Protein: ENSMUSP00000121830
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Pfam:Trypsin 232 298 4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152034
SMART Domains Protein: ENSMUSP00000117312
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Pfam:Trypsin 232 297 1.1e-15 PFAM
Meta Mutation Damage Score 0.7294 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes factor X, a component of both the intrinsic and extrinsic blood coagulation pathways. The encoded protein is a zymogen that undergoes further processing in a vitamin K-dependent manner to generate mature factor X, a heterodimer comprised of disulfide-linked heavy and light chains. The mature factor X is proteolytically activated either by factor IXa (intrinsic pathway) or factor VIIa (extrinsic pathway) to form factor Xa serine endopeptidase. Activated factor Xa catalyzes the conversion of prothrombin to thrombin. A complete lack of the encoded protein is fatal to mice. A severe deficiency of the encoded protein in mice causes age-dependent iron deposition and cardiac fibrosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Most homozygous mice die from fatal bleeding events at embryonic and neonatal stages, with the remaining homozygous mice dying before weaning stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,563,556 I18V probably benign Het
Adamdec1 T G 14: 68,568,712 E438A possibly damaging Het
Adamts17 A G 7: 66,915,898 probably null Het
Ankrd44 T G 1: 54,743,339 I359L possibly damaging Het
Ap2s1 C A 7: 16,747,365 N86K probably damaging Het
Arih1 T A 9: 59,426,710 probably benign Het
Astn1 T A 1: 158,509,891 I389N probably damaging Het
Brca2 T C 5: 150,569,392 S3291P possibly damaging Het
Cacna1d T C 14: 30,100,688 probably benign Het
Ccl7 C A 11: 82,045,866 probably benign Het
Cd74 A T 18: 60,811,414 Y232F possibly damaging Het
Cep128 A G 12: 91,230,867 probably benign Het
Cep89 T A 7: 35,416,402 probably benign Het
Cmya5 T G 13: 93,089,856 N2908T probably benign Het
Coil T C 11: 88,981,986 L391S possibly damaging Het
Cpd C T 11: 76,785,204 V1208I probably benign Het
Ddx19a T C 8: 110,979,057 D254G probably damaging Het
Desi2 T A 1: 178,256,321 probably benign Het
Dnah11 A T 12: 117,911,058 M4024K probably damaging Het
Ergic2 A T 6: 148,183,144 L53H probably damaging Het
Etv2 T C 7: 30,634,633 Y225C probably benign Het
Fam228b T A 12: 4,762,382 D132V probably damaging Het
Fat2 T A 11: 55,284,134 I1918F possibly damaging Het
Fbxw5 C T 2: 25,503,239 S214F probably damaging Het
Glyat G A 19: 12,651,453 R204Q possibly damaging Het
Gm4825 T C 15: 85,510,981 noncoding transcript Het
Ino80d G T 1: 63,086,276 T9K possibly damaging Het
Lifr A T 15: 7,166,914 D193V probably damaging Het
Lrp12 G T 15: 39,878,911 probably benign Het
Lrp3 A G 7: 35,202,353 V701A probably benign Het
Mfsd11 T A 11: 116,865,882 probably benign Het
Mrto4 A T 4: 139,349,732 probably null Het
Msi1 T C 5: 115,430,649 F43L possibly damaging Het
Mthfsd T C 8: 121,101,237 D168G probably damaging Het
Myo15 T A 11: 60,511,174 V3099E probably damaging Het
Myrf T C 19: 10,215,812 probably null Het
Nadk C A 4: 155,587,799 probably benign Het
Nav1 T C 1: 135,471,126 K573E possibly damaging Het
Ndufs3 A G 2: 90,898,388 V207A probably damaging Het
Nlrp3 T C 11: 59,555,924 probably benign Het
Nlrx1 T G 9: 44,262,914 D330A probably benign Het
Olfr331 T C 11: 58,502,396 I53M unknown Het
Olfr444 G A 6: 42,955,570 C24Y probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pcnx A T 12: 81,974,466 I1410F probably benign Het
Piezo2 G A 18: 63,024,491 R2383C probably damaging Het
Pip5kl1 A T 2: 32,583,424 K358* probably null Het
Polg T C 7: 79,452,240 probably benign Het
Prr14l T A 5: 32,828,717 I1145F probably benign Het
Psmb1 C T 17: 15,494,519 V39I probably benign Het
Ptk6 T C 2: 181,202,308 Y66C possibly damaging Het
Robo4 T C 9: 37,404,766 probably benign Het
Sdk2 A G 11: 113,803,203 Y1801H probably damaging Het
Serpinb3a C A 1: 107,049,386 A95S probably benign Het
Setd1a CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,297 probably benign Het
Sik2 A T 9: 50,995,632 Y98N probably damaging Het
Slc30a1 C T 1: 191,909,726 P495S probably benign Het
Smg1 A T 7: 118,184,461 probably benign Het
Stk3 T A 15: 35,114,632 I45L probably benign Het
Tapbp A G 17: 33,925,418 T163A probably damaging Het
Tdrd5 T C 1: 156,285,481 K410E probably damaging Het
Trim30b A T 7: 104,363,766 M152K probably benign Het
Trpm6 G T 19: 18,783,025 probably benign Het
Tsc22d1 T C 14: 76,505,303 probably benign Het
U2surp A T 9: 95,485,607 F444I probably damaging Het
Vmn2r95 C T 17: 18,441,402 P470L probably damaging Het
Zc3h4 T G 7: 16,420,275 Y163D probably damaging Het
Zfp62 A T 11: 49,215,676 H198L probably damaging Het
Zmym1 A G 4: 127,058,820 L56P probably benign Het
Other mutations in F10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:F10 APN 8 13055686 missense probably damaging 1.00
IGL01296:F10 APN 8 13055383 missense possibly damaging 0.49
IGL02010:F10 APN 8 13048292 missense probably damaging 0.97
IGL02707:F10 APN 8 13048252 missense probably damaging 1.00
IGL02716:F10 APN 8 13048177 nonsense probably null
IGL03354:F10 APN 8 13045089 missense probably benign 0.00
ju UTSW 8 13055698 missense probably damaging 1.00
PIT4494001:F10 UTSW 8 13053423 missense probably damaging 1.00
R0243:F10 UTSW 8 13048196 missense probably damaging 1.00
R0321:F10 UTSW 8 13053413 missense possibly damaging 0.95
R0421:F10 UTSW 8 13045097 missense probably benign 0.05
R0545:F10 UTSW 8 13048249 missense probably damaging 1.00
R1630:F10 UTSW 8 13055551 missense probably benign 0.00
R1732:F10 UTSW 8 13050764 missense probably damaging 1.00
R1956:F10 UTSW 8 13055422 missense probably damaging 1.00
R4130:F10 UTSW 8 13055584 missense possibly damaging 0.94
R4700:F10 UTSW 8 13039621 missense possibly damaging 0.93
R4989:F10 UTSW 8 13055698 missense probably damaging 1.00
R5133:F10 UTSW 8 13055698 missense probably damaging 1.00
R5134:F10 UTSW 8 13055698 missense probably damaging 1.00
R6826:F10 UTSW 8 13046165 splice site probably null
R7601:F10 UTSW 8 13050781 missense probably benign 0.26
X0024:F10 UTSW 8 13055859 missense probably benign
Z1177:F10 UTSW 8 13037845 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTCTGGCCCCAGGTGATCGGAAC -3'
(R):5'- ACCAGATGTGACCCAGCAGGACTG -3'

Sequencing Primer
(F):5'- CCAGGTGATCGGAACACAGAG -3'
(R):5'- CCTGTCAATCCACTTGAGGAAGG -3'
Posted On2013-05-23