Incidental Mutation 'R0416:Prr14l'
ID40305
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Nameproline rich 14-like
Synonyms
MMRRC Submission 038618-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R0416 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location32789820-32854256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32828717 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1145 (I1145F)
Ref Sequence ENSEMBL: ENSMUSP00000113259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000144673] [ENSMUST00000155392]
Predicted Effect probably benign
Transcript: ENSMUST00000120129
AA Change: I1145F

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: I1145F

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144673
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155392
SMART Domains Protein: ENSMUSP00000119569
Gene: ENSMUSG00000054280

DomainStartEndE-ValueType
low complexity region 276 289 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,563,556 I18V probably benign Het
Adamdec1 T G 14: 68,568,712 E438A possibly damaging Het
Adamts17 A G 7: 66,915,898 probably null Het
Ankrd44 T G 1: 54,743,339 I359L possibly damaging Het
Ap2s1 C A 7: 16,747,365 N86K probably damaging Het
Arih1 T A 9: 59,426,710 probably benign Het
Astn1 T A 1: 158,509,891 I389N probably damaging Het
Brca2 T C 5: 150,569,392 S3291P possibly damaging Het
Cacna1d T C 14: 30,100,688 probably benign Het
Ccl7 C A 11: 82,045,866 probably benign Het
Cd74 A T 18: 60,811,414 Y232F possibly damaging Het
Cep128 A G 12: 91,230,867 probably benign Het
Cep89 T A 7: 35,416,402 probably benign Het
Cmya5 T G 13: 93,089,856 N2908T probably benign Het
Coil T C 11: 88,981,986 L391S possibly damaging Het
Cpd C T 11: 76,785,204 V1208I probably benign Het
Ddx19a T C 8: 110,979,057 D254G probably damaging Het
Desi2 T A 1: 178,256,321 probably benign Het
Dnah11 A T 12: 117,911,058 M4024K probably damaging Het
Ergic2 A T 6: 148,183,144 L53H probably damaging Het
Etv2 T C 7: 30,634,633 Y225C probably benign Het
F10 G A 8: 13,055,448 A338T probably damaging Het
Fam228b T A 12: 4,762,382 D132V probably damaging Het
Fat2 T A 11: 55,284,134 I1918F possibly damaging Het
Fbxw5 C T 2: 25,503,239 S214F probably damaging Het
Glyat G A 19: 12,651,453 R204Q possibly damaging Het
Gm4825 T C 15: 85,510,981 noncoding transcript Het
Ino80d G T 1: 63,086,276 T9K possibly damaging Het
Lifr A T 15: 7,166,914 D193V probably damaging Het
Lrp12 G T 15: 39,878,911 probably benign Het
Lrp3 A G 7: 35,202,353 V701A probably benign Het
Mfsd11 T A 11: 116,865,882 probably benign Het
Mrto4 A T 4: 139,349,732 probably null Het
Msi1 T C 5: 115,430,649 F43L possibly damaging Het
Mthfsd T C 8: 121,101,237 D168G probably damaging Het
Myo15 T A 11: 60,511,174 V3099E probably damaging Het
Myrf T C 19: 10,215,812 probably null Het
Nadk C A 4: 155,587,799 probably benign Het
Nav1 T C 1: 135,471,126 K573E possibly damaging Het
Ndufs3 A G 2: 90,898,388 V207A probably damaging Het
Nlrp3 T C 11: 59,555,924 probably benign Het
Nlrx1 T G 9: 44,262,914 D330A probably benign Het
Olfr331 T C 11: 58,502,396 I53M unknown Het
Olfr444 G A 6: 42,955,570 C24Y probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pcnx A T 12: 81,974,466 I1410F probably benign Het
Piezo2 G A 18: 63,024,491 R2383C probably damaging Het
Pip5kl1 A T 2: 32,583,424 K358* probably null Het
Polg T C 7: 79,452,240 probably benign Het
Psmb1 C T 17: 15,494,519 V39I probably benign Het
Ptk6 T C 2: 181,202,308 Y66C possibly damaging Het
Robo4 T C 9: 37,404,766 probably benign Het
Sdk2 A G 11: 113,803,203 Y1801H probably damaging Het
Serpinb3a C A 1: 107,049,386 A95S probably benign Het
Setd1a CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,297 probably benign Het
Sik2 A T 9: 50,995,632 Y98N probably damaging Het
Slc30a1 C T 1: 191,909,726 P495S probably benign Het
Smg1 A T 7: 118,184,461 probably benign Het
Stk3 T A 15: 35,114,632 I45L probably benign Het
Tapbp A G 17: 33,925,418 T163A probably damaging Het
Tdrd5 T C 1: 156,285,481 K410E probably damaging Het
Trim30b A T 7: 104,363,766 M152K probably benign Het
Trpm6 G T 19: 18,783,025 probably benign Het
Tsc22d1 T C 14: 76,505,303 probably benign Het
U2surp A T 9: 95,485,607 F444I probably damaging Het
Vmn2r95 C T 17: 18,441,402 P470L probably damaging Het
Zc3h4 T G 7: 16,420,275 Y163D probably damaging Het
Zfp62 A T 11: 49,215,676 H198L probably damaging Het
Zmym1 A G 4: 127,058,820 L56P probably benign Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32830676 missense probably benign 0.04
IGL00331:Prr14l APN 5 32831066 missense probably benign 0.02
IGL01571:Prr14l APN 5 32828806 missense probably benign 0.01
IGL01795:Prr14l APN 5 32831845 unclassified probably benign
IGL01929:Prr14l APN 5 32828243 missense probably benign 0.09
IGL01959:Prr14l APN 5 32830205 missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32827532 missense probably damaging 1.00
IGL02321:Prr14l APN 5 32827807 missense probably benign 0.10
IGL02508:Prr14l APN 5 32830942 missense probably benign 0.01
IGL02551:Prr14l APN 5 32831484 missense probably damaging 1.00
IGL02585:Prr14l APN 5 32829484 missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32830543 missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32828182 missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32831096 missense probably benign 0.42
IGL02952:Prr14l APN 5 32835670 missense unknown
IGL03034:Prr14l APN 5 32827438 missense possibly damaging 0.48
Polymer UTSW 5 32827145 missense probably benign 0.34
Postwar UTSW 5 32830684 missense probably benign 0.17
H8562:Prr14l UTSW 5 32793728 missense probably damaging 1.00
R0086:Prr14l UTSW 5 32831559 unclassified probably benign
R0149:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0333:Prr14l UTSW 5 32827993 missense probably damaging 1.00
R0361:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0480:Prr14l UTSW 5 32829880 missense probably benign 0.02
R0511:Prr14l UTSW 5 32844216 intron probably benign
R0639:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0673:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0743:Prr14l UTSW 5 32831194 missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32828423 missense probably damaging 1.00
R1006:Prr14l UTSW 5 32829482 missense probably benign 0.00
R1342:Prr14l UTSW 5 32830260 missense probably damaging 1.00
R1433:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R1527:Prr14l UTSW 5 32827949 missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32830282 missense probably benign 0.01
R1967:Prr14l UTSW 5 32844469 intron probably benign
R2129:Prr14l UTSW 5 32831828 unclassified probably benign
R2150:Prr14l UTSW 5 32830702 missense probably benign 0.14
R2318:Prr14l UTSW 5 32830078 missense probably benign 0.04
R2915:Prr14l UTSW 5 32829768 missense probably benign 0.04
R3551:Prr14l UTSW 5 32828619 unclassified probably null
R3820:Prr14l UTSW 5 32828984 missense probably damaging 0.99
R3852:Prr14l UTSW 5 32830345 missense probably damaging 1.00
R4126:Prr14l UTSW 5 32828003 missense probably damaging 0.97
R4345:Prr14l UTSW 5 32828576 missense probably damaging 1.00
R4388:Prr14l UTSW 5 32829254 missense probably damaging 1.00
R4575:Prr14l UTSW 5 32793644 missense probably damaging 1.00
R4596:Prr14l UTSW 5 32829308 missense probably benign 0.01
R4690:Prr14l UTSW 5 32844156 intron probably benign
R4824:Prr14l UTSW 5 32844399 intron probably benign
R4868:Prr14l UTSW 5 32829937 missense probably benign 0.04
R4869:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R5201:Prr14l UTSW 5 32830247 missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32830021 missense probably benign 0.00
R5410:Prr14l UTSW 5 32827777 missense probably damaging 0.98
R5476:Prr14l UTSW 5 32844138 intron probably benign
R5623:Prr14l UTSW 5 32844508 intron probably benign
R5730:Prr14l UTSW 5 32793603 missense probably damaging 1.00
R5988:Prr14l UTSW 5 32830851 missense probably damaging 0.98
R6261:Prr14l UTSW 5 32829404 missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32830264 missense probably benign 0.14
R6307:Prr14l UTSW 5 32827525 missense probably damaging 0.97
R6825:Prr14l UTSW 5 32828548 missense possibly damaging 0.86
R6862:Prr14l UTSW 5 32827759 missense probably damaging 1.00
R6880:Prr14l UTSW 5 32830867 missense probably benign 0.01
R6931:Prr14l UTSW 5 32830691 missense probably damaging 0.98
R7101:Prr14l UTSW 5 32829427 missense probably damaging 1.00
R7164:Prr14l UTSW 5 32829166 missense probably damaging 1.00
R7203:Prr14l UTSW 5 32827145 missense probably benign 0.34
R7211:Prr14l UTSW 5 32830087 missense probably damaging 0.98
R7305:Prr14l UTSW 5 32831101 missense probably benign 0.14
R7346:Prr14l UTSW 5 32830684 missense probably benign 0.17
R7395:Prr14l UTSW 5 32828638 missense probably benign 0.00
R7624:Prr14l UTSW 5 32829623 missense possibly damaging 0.54
R7649:Prr14l UTSW 5 32828245 missense probably benign 0.18
R7753:Prr14l UTSW 5 32827253 missense probably damaging 1.00
R7828:Prr14l UTSW 5 32844391 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGACACTGTGCCTGACGACAAG -3'
(R):5'- GGGTGCCAAGACTCTGTCAAGATG -3'

Sequencing Primer
(F):5'- ACGACAAGTGTTGTCCCAG -3'
(R):5'- TCGGGAACATTCACCAGC -3'
Posted On2013-05-23