Incidental Mutation 'R5302:Klhl12'
List |< first << previous [record 22 of 42] next >> last >|
ID404280
Institutional Source Beutler Lab
Gene Symbol Klhl12
Ensembl Gene ENSMUSG00000026455
Gene Namekelch-like 12
SynonymsC3ip1
MMRRC Submission 042885-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5302 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location134455531-134491018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134489451 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 540 (E540G)
Ref Sequence ENSEMBL: ENSMUSP00000107851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027725] [ENSMUST00000112232] [ENSMUST00000116528]
Predicted Effect probably benign
Transcript: ENSMUST00000027725
AA Change: E567G

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027725
Gene: ENSMUSG00000026455
AA Change: E567G

DomainStartEndE-ValueType
BTB 33 130 1.9e-30 SMART
BACK 135 237 5.39e-34 SMART
Kelch 282 329 1.9e-9 SMART
Kelch 330 379 3.18e-11 SMART
Kelch 380 426 1.85e-12 SMART
Kelch 427 473 3.11e-14 SMART
Kelch 474 520 1.74e-17 SMART
Kelch 521 567 4.71e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112232
AA Change: E540G

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107851
Gene: ENSMUSG00000026455
AA Change: E540G

DomainStartEndE-ValueType
BTB 33 130 1.9e-30 SMART
BACK 135 237 5.39e-34 SMART
Kelch 282 329 1.9e-9 SMART
Kelch 330 379 3.18e-11 SMART
Kelch 380 426 1.85e-12 SMART
Kelch 427 493 3.39e-6 SMART
Kelch 494 540 4.71e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116528
AA Change: E567G

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112227
Gene: ENSMUSG00000026455
AA Change: E567G

DomainStartEndE-ValueType
BTB 33 130 1.9e-30 SMART
BACK 135 237 5.39e-34 SMART
Kelch 282 329 1.9e-9 SMART
Kelch 330 379 3.18e-11 SMART
Kelch 380 426 1.85e-12 SMART
Kelch 427 473 3.11e-14 SMART
Kelch 474 520 1.74e-17 SMART
Kelch 521 567 4.71e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141458
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KLHL (Kelch-like) family of proteins. This protein has been identified as an autoantigen in the autoimmune disease Sjogren's syndrome and as a potential biomarker in primary biliary cirrhosis. This protein may act as a substrate adaptor of the Cullin-3 ubiquitin ligase complex to promote substrate-specific ubiquitylation. Ubiquitylation by this complex has been shown to regulate the Wnt signaling pathway as well as COPII vesicle coat size. A pseudogene has been identified on chromosome 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,952 V1657A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Acot5 A G 12: 84,073,441 Y190C probably damaging Het
Ascc3 T A 10: 50,707,777 Y941N probably benign Het
BC035947 A T 1: 78,511,962 M1K probably null Het
C2cd5 A G 6: 143,073,756 C278R probably benign Het
Cd200r1 G T 16: 44,792,809 L259F possibly damaging Het
Clcn4 A G 7: 7,294,051 V136A possibly damaging Het
Cntnap5a T C 1: 116,157,570 S413P probably benign Het
Corin T A 5: 72,316,098 E748D probably benign Het
Crtc2 G T 3: 90,261,018 G356V probably damaging Het
D1Pas1 T A 1: 186,969,445 Y524N probably damaging Het
Dlgap4 T C 2: 156,760,898 S147P probably damaging Het
Enpp1 A T 10: 24,651,390 I633N probably benign Het
Gm3095 A G 14: 3,964,498 D72G probably null Het
Gm5449 C T 13: 53,525,751 noncoding transcript Het
Gm6803 T A 12: 88,018,546 I76F probably damaging Het
Gpx7 T C 4: 108,400,914 T161A probably benign Het
Grip1 T C 10: 120,020,077 L236P probably damaging Het
H2-Q2 G T 17: 35,344,909 R255S probably damaging Het
Il17rc G T 6: 113,483,036 A648S possibly damaging Het
Mcm10 T C 2: 5,007,370 I135V probably benign Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Nid2 A G 14: 19,779,701 T687A probably benign Het
Npas3 A T 12: 54,068,836 D829V probably damaging Het
Ocln T C 13: 100,506,299 D176G probably damaging Het
Olfr745 A G 14: 50,642,319 probably null Het
Pax3 A C 1: 78,121,612 M380R possibly damaging Het
Pcdha3 A G 18: 36,948,155 E650G probably damaging Het
Pdcd11 C A 19: 47,107,644 H668N probably damaging Het
Polr3b T C 10: 84,699,400 Y858H possibly damaging Het
Pus10 T C 11: 23,667,416 probably null Het
Raver1 T C 9: 21,075,381 D739G probably damaging Het
Slc26a11 T C 11: 119,363,450 L198P probably damaging Het
Slc44a3 A G 3: 121,510,313 V258A probably damaging Het
Socs7 T A 11: 97,389,199 I524N probably damaging Het
Steap4 T A 5: 7,975,547 L36* probably null Het
Svep1 G C 4: 58,096,183 T1479S possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ttn C A 2: 76,717,275 V32184F probably damaging Het
Vmn1r22 T C 6: 57,900,975 N6D possibly damaging Het
Other mutations in Klhl12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Klhl12 APN 1 134483753 missense probably benign
IGL01834:Klhl12 APN 1 134489420 missense probably damaging 1.00
IGL01947:Klhl12 APN 1 134463951 missense probably damaging 1.00
IGL02005:Klhl12 APN 1 134463914 missense possibly damaging 0.91
IGL02550:Klhl12 APN 1 134467705 missense possibly damaging 0.94
R0403:Klhl12 UTSW 1 134485856 missense possibly damaging 0.82
R1508:Klhl12 UTSW 1 134488974 missense possibly damaging 0.58
R1801:Klhl12 UTSW 1 134489070 missense probably damaging 1.00
R4384:Klhl12 UTSW 1 134487654 missense probably damaging 1.00
R4569:Klhl12 UTSW 1 134485769 missense probably benign 0.23
R5503:Klhl12 UTSW 1 134485915 critical splice donor site probably null
R5877:Klhl12 UTSW 1 134483820 nonsense probably null
R6918:Klhl12 UTSW 1 134475846 missense possibly damaging 0.46
R7126:Klhl12 UTSW 1 134467783 missense probably damaging 0.97
R7688:Klhl12 UTSW 1 134489030 missense probably benign 0.01
R7897:Klhl12 UTSW 1 134458481 missense probably benign 0.00
R7898:Klhl12 UTSW 1 134458481 missense probably benign 0.00
R7958:Klhl12 UTSW 1 134467717 missense probably benign 0.02
R7989:Klhl12 UTSW 1 134489405 missense probably benign
R8299:Klhl12 UTSW 1 134488940 missense probably damaging 1.00
R8344:Klhl12 UTSW 1 134485722 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTTGTATGTAAAGTGATGGAGACC -3'
(R):5'- GGTTTCCCACATCCAAACGTG -3'

Sequencing Primer
(F):5'- AGTGATGGAGACCTCATTTCTTTC -3'
(R):5'- CTTCTGAGCAAGATGACCAGTGC -3'
Posted On2016-07-22