Incidental Mutation 'R5288:Tnfrsf11b'
ID424539
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11b
Ensembl Gene ENSMUSG00000063727
Gene Nametumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)
SynonymsOpg, OCIF, OPG, TR1, osteoclastogenesis inhibitory factor
MMRRC Submission 042842-MU
Accession Numbers

NCBI RefSeq: NM_008764.3; MGI:109587

Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5288 (G1)
Quality Score214
Status Not validated
Chromosome15
Chromosomal Location54250619-54278484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54278226 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 8 (A8T)
Ref Sequence ENSEMBL: ENSMUSP00000078705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079772]
PDB Structure Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000079772
AA Change: A8T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078705
Gene: ENSMUSG00000063727
AA Change: A8T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 24 62 1.04e-2 SMART
TNFR 65 105 1.5e-8 SMART
TNFR 107 142 2.19e-10 SMART
TNFR 145 185 7.63e-1 SMART
DEATH 270 365 1.01e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype Strain: 2181227
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have abnormal bone remodeling that results in severe osteoperosis with increased risk of fractures and growth retardation. Progressive hearing loss also results due to abnormal remodeling of the otic capsule. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T G 16: 13,677,758 N240K probably benign Het
Abcc12 A T 8: 86,566,539 Y7N probably damaging Het
Adcy1 A C 11: 7,161,351 I881L probably benign Het
Aftph T C 11: 20,726,994 D205G probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
C87414 C T 5: 93,637,748 M224I possibly damaging Het
Ccdc88a T G 11: 29,498,416 N1465K possibly damaging Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cep70 T A 9: 99,281,075 L325Q probably damaging Het
Cfap46 A G 7: 139,613,507 probably null Het
Cftr C T 6: 18,226,129 Q359* probably null Het
Chrne A T 11: 70,615,087 N457K possibly damaging Het
Cntn2 A G 1: 132,523,677 I438T probably benign Het
Cntn4 T C 6: 106,181,804 L10P possibly damaging Het
Copg1 G T 6: 87,890,207 M87I possibly damaging Het
Cyfip1 A T 7: 55,925,135 M1045L possibly damaging Het
Cyp2c29 C T 19: 39,330,372 P432L probably damaging Het
Dcaf11 T A 14: 55,563,376 D96E probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnhd1 G A 7: 105,714,437 E4069K possibly damaging Het
Dpy19l4 T A 4: 11,289,721 N330I probably damaging Het
Dpy19l4 G T 4: 11,304,014 A132D probably damaging Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp11 T C 6: 85,947,605 *322W probably null Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Eml3 G A 19: 8,939,274 G720S probably damaging Het
F11 A G 8: 45,246,796 S418P probably damaging Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fat2 G A 11: 55,267,656 T3412I probably benign Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Gm10134 T A 2: 28,506,360 probably benign Het
Gm11787 T C 4: 3,511,795 noncoding transcript Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hephl1 T C 9: 15,076,854 T653A possibly damaging Het
Herc3 T A 6: 58,874,278 M504K probably damaging Het
Hmcn2 A G 2: 31,460,321 T5077A probably benign Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Ighe T C 12: 113,271,472 H356R probably benign Het
Ighv10-3 T A 12: 114,523,505 M99L probably benign Het
Izumo4 C A 10: 80,702,805 C30* probably null Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kif24 T C 4: 41,395,373 E500G probably benign Het
Kng1 A T 16: 23,079,092 D414V probably damaging Het
Loxhd1 A C 18: 77,363,612 D410A probably damaging Het
Ltn1 T C 16: 87,416,011 K554R possibly damaging Het
Ly75 A G 2: 60,303,641 C1547R probably damaging Het
Ms4a6d A T 19: 11,587,136 S124T possibly damaging Het
Mtfr2 A G 10: 20,357,702 D339G probably damaging Het
Myh10 T A 11: 68,801,608 L1369Q probably damaging Het
Myh11 A T 16: 14,208,008 V1366D possibly damaging Het
Nadsyn1 A G 7: 143,803,286 V491A possibly damaging Het
Nav3 T C 10: 109,853,105 N437S probably benign Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Neb A T 2: 52,189,861 I85N probably damaging Het
Nktr A G 9: 121,748,593 K576E probably benign Het
Nmur2 T A 11: 56,040,214 I224F probably damaging Het
Oas3 A G 5: 120,756,990 F978S probably damaging Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1331 T C 4: 118,869,575 S264P probably damaging Het
Olfr330 A T 11: 58,529,482 M168K probably damaging Het
Olfr457 T A 6: 42,471,252 I309F probably benign Het
Olfr484 T C 7: 108,125,168 T32A probably benign Het
Pcyox1 A T 6: 86,392,354 probably null Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pitpnm1 T C 19: 4,103,435 F197S probably damaging Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Pomt1 C G 2: 32,244,299 Y277* probably null Het
Pou4f2 A G 8: 78,436,329 Y26H unknown Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Prdx2 T A 8: 84,971,673 Y164* probably null Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Rab4a A T 8: 123,827,374 I16L probably benign Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Rimbp2 G A 5: 128,788,592 T557M probably benign Het
Rmi1 G A 13: 58,409,466 G510R probably damaging Het
Sdad1 A G 5: 92,286,825 *687Q probably null Het
Sema6d T C 2: 124,664,246 L720P probably damaging Het
Setx T G 2: 29,134,033 probably null Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Strn3 C G 12: 51,648,020 R320P probably damaging Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Syne2 T A 12: 76,099,338 S6377T possibly damaging Het
Tas2r123 A T 6: 132,847,227 H29L probably benign Het
Tbl3 C T 17: 24,705,970 V52M possibly damaging Het
Tbp A G 17: 15,507,347 I145V probably benign Het
Tcf20 A T 15: 82,855,709 S514T possibly damaging Het
Tgm4 A G 9: 123,056,494 Y367C probably damaging Het
Tle1 C T 4: 72,141,844 V258M probably damaging Het
Tln1 C T 4: 43,540,661 V1447I probably benign Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Tsen15 C T 1: 152,383,380 V76I probably damaging Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Ucn3 A T 13: 3,941,474 F59L probably benign Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vmn2r94 A C 17: 18,244,466 Y521D probably damaging Het
Vps45 T C 3: 96,057,774 M1V probably null Het
Vta1 C A 10: 14,705,399 L21F probably damaging Het
Zdhhc21 C T 4: 82,847,692 G2D probably damaging Het
Zfp169 A T 13: 48,490,275 C459S possibly damaging Het
Zfp90 C T 8: 106,425,368 T571M probably damaging Het
Zswim8 A T 14: 20,718,871 N1119I possibly damaging Het
Other mutations in Tnfrsf11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnfrsf11b APN 15 54259842 missense probably damaging 1.00
IGL00770:Tnfrsf11b APN 15 54254072 missense probably benign 0.16
IGL00774:Tnfrsf11b APN 15 54254072 missense probably benign 0.16
IGL02355:Tnfrsf11b APN 15 54252382 missense probably damaging 0.96
IGL02362:Tnfrsf11b APN 15 54252382 missense probably damaging 0.96
IGL02711:Tnfrsf11b APN 15 54256136 missense probably benign 0.01
IGL02870:Tnfrsf11b APN 15 54256027 missense probably benign 0.05
IGL03219:Tnfrsf11b APN 15 54254178 nonsense probably null
P0012:Tnfrsf11b UTSW 15 54259798 splice site probably benign
R1550:Tnfrsf11b UTSW 15 54254058 missense possibly damaging 0.94
R1813:Tnfrsf11b UTSW 15 54256097 nonsense probably null
R3840:Tnfrsf11b UTSW 15 54252082 missense probably damaging 0.99
R3910:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R3911:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R3912:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R4299:Tnfrsf11b UTSW 15 54252095 missense probably benign
R4362:Tnfrsf11b UTSW 15 54256159 missense possibly damaging 0.94
R4363:Tnfrsf11b UTSW 15 54256159 missense possibly damaging 0.94
R5653:Tnfrsf11b UTSW 15 54259866 missense probably damaging 1.00
R5753:Tnfrsf11b UTSW 15 54254059 missense possibly damaging 0.90
R6881:Tnfrsf11b UTSW 15 54254143 missense probably benign 0.00
R6997:Tnfrsf11b UTSW 15 54252374 missense probably damaging 0.99
R7704:Tnfrsf11b UTSW 15 54260101 missense probably benign 0.30
R7730:Tnfrsf11b UTSW 15 54254074 nonsense probably null
R8017:Tnfrsf11b UTSW 15 54254202 nonsense probably null
R8052:Tnfrsf11b UTSW 15 54252106 missense probably damaging 1.00
R8060:Tnfrsf11b UTSW 15 54254109 missense probably benign 0.38
X0025:Tnfrsf11b UTSW 15 54278235 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ATTCACTCTTCAGGGCAGCC -3'
(R):5'- CTAAAGCGTTAACCCCGGAG -3'

Sequencing Primer
(F):5'- TCTTCAGGGCAGCCTGCTG -3'
(R):5'- TAGCTCCCAAGGTTCCTAAAAAGG -3'
Posted On2016-08-04