Incidental Mutation 'R5443:Carhsp1'
ID427298
Institutional Source Beutler Lab
Gene Symbol Carhsp1
Ensembl Gene ENSMUSG00000008393
Gene Namecalcium regulated heat stable protein 1
SynonymsD16Ertd465e, 1200011K09Rik
MMRRC Submission 043008-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock #R5443 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location8658580-8672155 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8664339 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 26 (R26L)
Ref Sequence ENSEMBL: ENSMUSP00000008537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008537] [ENSMUST00000230828]
Predicted Effect probably benign
Transcript: ENSMUST00000008537
AA Change: R26L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000008537
Gene: ENSMUSG00000008393
AA Change: R26L

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
CSP 65 130 1.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230828
Meta Mutation Damage Score 0.1038 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.9%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,927,211 Q168K probably benign Het
Akap12 A T 10: 4,355,576 E795D probably damaging Het
Aldh6a1 T C 12: 84,437,971 probably null Het
Aox4 A G 1: 58,233,992 probably null Het
Arhgap39 G A 15: 76,797,925 probably benign Het
AW551984 T C 9: 39,598,029 E272G possibly damaging Het
C1qc G A 4: 136,892,493 probably benign Het
Cdh12 G T 15: 21,237,849 V57L probably benign Het
Clec3a A G 8: 114,418,153 Y23C probably benign Het
Crebrf G C 17: 26,742,354 V150L probably damaging Het
Ddx41 G T 13: 55,535,291 A201E probably benign Het
Doc2b T C 11: 75,780,095 K237E probably damaging Het
Dst T C 1: 34,228,539 S5199P probably damaging Het
Efnb2 A G 8: 8,620,862 I129T probably damaging Het
Epg5 A G 18: 78,027,497 E2329G possibly damaging Het
Esrrg A C 1: 188,043,425 T27P possibly damaging Het
Fah T A 7: 84,592,396 R316W probably damaging Het
Fat4 T C 3: 39,010,370 L4825P probably damaging Het
Gabbr1 T C 17: 37,070,756 V804A probably damaging Het
Gm1322 G A 2: 67,184,668 noncoding transcript Het
Gm5114 T A 7: 39,408,865 K443N probably benign Het
Gnai2 T C 9: 107,620,187 I3V probably damaging Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
I830127L07Rik A T 15: 75,133,719 noncoding transcript Het
Klf15 C A 6: 90,467,360 Q306K possibly damaging Het
Necab2 A T 8: 119,468,293 M295L probably benign Het
Nrg1 A T 8: 31,849,320 Y208N probably damaging Het
Nup88 A T 11: 70,958,430 Y232* probably null Het
Oacyl A G 18: 65,750,182 R611G probably benign Het
Oasl1 T C 5: 114,936,070 probably null Het
Olfr1061 A C 2: 86,413,593 I153R possibly damaging Het
Olfr138 T A 17: 38,275,014 M81K probably damaging Het
Olfr1384 G T 11: 49,514,435 G266C probably damaging Het
Olfr652 T C 7: 104,564,376 Y52H probably benign Het
Pate4 A C 9: 35,607,874 S66A possibly damaging Het
Pigl T A 11: 62,458,483 C8* probably null Het
Plg G A 17: 12,382,183 A51T probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppig A T 2: 69,734,291 D97V probably damaging Het
Ppp1r16a A G 15: 76,694,646 K517E possibly damaging Het
Prr16 A T 18: 51,303,153 S235C probably damaging Het
Psmd1 G A 1: 86,090,183 R572H probably damaging Het
Sbf2 T C 7: 110,377,928 probably benign Het
Scrt2 A T 2: 152,082,123 Y25F probably benign Het
Sema6d A T 2: 124,656,836 H222L probably damaging Het
Sept2 A G 1: 93,497,452 N110S possibly damaging Het
Shpk G A 11: 73,222,781 G340D possibly damaging Het
Smg5 T A 3: 88,354,589 L723H probably damaging Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Spo11 T C 2: 172,989,359 probably benign Het
Srarp T A 4: 141,436,077 probably null Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tm9sf2 A T 14: 122,126,195 Y109F probably damaging Het
Tmem57 A T 4: 134,833,308 C121* probably null Het
Tpcn2 A T 7: 145,255,472 M699K possibly damaging Het
Trim34a T C 7: 104,260,213 F289S possibly damaging Het
Trim39 T C 17: 36,260,753 H371R probably damaging Het
Usp48 T A 4: 137,621,221 I11N possibly damaging Het
Zbtb10 T C 3: 9,280,048 F677L probably benign Het
Zer1 C T 2: 30,110,996 G138S probably damaging Het
Zfp612 A G 8: 110,089,595 K439R possibly damaging Het
Other mutations in Carhsp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Carhsp1 APN 16 8663713 unclassified probably benign
R4659:Carhsp1 UTSW 16 8664265 missense probably benign 0.18
R4903:Carhsp1 UTSW 16 8661000 missense probably damaging 0.98
R5626:Carhsp1 UTSW 16 8661033 missense probably benign 0.25
R7014:Carhsp1 UTSW 16 8661005 missense probably benign 0.32
R8247:Carhsp1 UTSW 16 8663671 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGGCACCCTCCTGTTTTC -3'
(R):5'- GACACTTGAGCCAAGGTGTG -3'

Sequencing Primer
(F):5'- GGCACCCTCCTGTTTTCTCACTAG -3'
(R):5'- CTTGAGCCAAGGTGTGACTATAGAC -3'
Posted On2016-09-01