Incidental Mutation 'R5530:Pot1a'
ID 433631
Institutional Source Beutler Lab
Gene Symbol Pot1a
Ensembl Gene ENSMUSG00000029676
Gene Name protection of telomeres 1A
Synonyms 1500031H18Rik, Pot1
MMRRC Submission 043088-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5530 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 25743737-25809246 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25778894 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 67 (E67G)
Ref Sequence ENSEMBL: ENSMUSP00000110982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115327] [ENSMUST00000115330] [ENSMUST00000166445]
AlphaFold Q91WC1
Predicted Effect probably damaging
Transcript: ENSMUST00000115327
AA Change: E67G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110982
Gene: ENSMUSG00000029676
AA Change: E67G

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115329
SMART Domains Protein: ENSMUSP00000110984
Gene: ENSMUSG00000029676

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115330
AA Change: E67G

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676
AA Change: E67G

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
Pfam:POT1PC 152 299 6.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156985
Predicted Effect possibly damaging
Transcript: ENSMUST00000166445
AA Change: E67G

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676
AA Change: E67G

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.3%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere length and protecting chromosome ends from illegitimate recombination, catastrophic chromosome instability, and abnormal chromosome segregation. Increased transcriptional expression of this gene is associated with stomach carcinogenesis and its progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Embryos homozygous for a gene trapped allele fail to form an inner cell mass in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415F23Rik A T 1: 23,101,990 I81N probably damaging Het
Abcb6 A G 1: 75,177,912 probably benign Het
Anapc2 A G 2: 25,284,583 K653E possibly damaging Het
Aplp1 T C 7: 30,436,829 S508G possibly damaging Het
Bend3 T A 10: 43,511,726 V705D probably damaging Het
Btaf1 C A 19: 36,990,775 A1120E possibly damaging Het
Carmil3 T C 14: 55,493,624 V116A probably damaging Het
Cdk5rap3 A T 11: 96,911,633 Y238* probably null Het
Cep170 T C 1: 176,769,510 H427R probably benign Het
Cubn G A 2: 13,308,523 R3079W probably damaging Het
Edc4 G T 8: 105,889,254 E694* probably null Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Fam189a2 T A 19: 23,975,594 T451S probably benign Het
Fbxo46 T C 7: 19,136,802 Y449H probably damaging Het
Ficd C A 5: 113,738,925 P387Q probably damaging Het
Grin2b T C 6: 135,733,723 T942A probably benign Het
Hoxb1 G C 11: 96,366,928 R228P probably damaging Het
Jmjd1c T C 10: 67,249,762 F2444L probably damaging Het
Kcnj2 T C 11: 111,072,091 F103S probably damaging Het
Mapkbp1 A G 2: 120,015,355 I402V probably benign Het
Mvp A G 7: 126,995,923 V250A probably benign Het
Myo1b T A 1: 51,797,423 N293I probably damaging Het
Npy5r T A 8: 66,680,860 Y427F probably benign Het
Nrd1 C T 4: 109,047,609 T747M probably damaging Het
Nrxn2 C T 19: 6,498,367 P30L possibly damaging Het
Nt5dc3 T C 10: 86,820,993 F332S probably damaging Het
Olfr116 A G 17: 37,623,807 I276T possibly damaging Het
Olfr876 A G 9: 37,804,807 T299A probably benign Het
Optc T G 1: 133,905,090 T91P probably benign Het
Otud7b A T 3: 96,141,488 E92V probably damaging Het
Pla2g4d A G 2: 120,269,555 I677T probably benign Het
Ppil6 T C 10: 41,507,498 S257P probably damaging Het
Ppp1r14a T C 7: 29,289,366 L11P probably benign Het
Pramef12 A T 4: 144,392,662 M445K probably benign Het
Rad21l A T 2: 151,657,510 I257K probably benign Het
Rbm11 A G 16: 75,592,973 D9G possibly damaging Het
Rhbdf2 T C 11: 116,600,662 Y586C probably damaging Het
Rxfp2 A T 5: 150,056,810 I276F probably damaging Het
Sec14l4 A G 11: 4,046,342 *404W probably null Het
Sec16a A G 2: 26,439,252 V917A probably benign Het
Sec61a2 A T 2: 5,882,650 Y131* probably null Het
Soga1 T A 2: 157,020,342 S1556C probably damaging Het
Sspo A T 6: 48,465,583 Y2004F probably damaging Het
Stab2 T C 10: 86,947,162 E674G probably benign Het
Tmem246 A G 4: 49,586,226 L314P probably benign Het
Tmf1 A G 6: 97,158,087 S989P probably damaging Het
Tshz1 T C 18: 84,013,268 D1005G probably damaging Het
Wdr19 T C 5: 65,228,219 S555P probably benign Het
Zdhhc24 T A 19: 4,883,563 probably null Het
Zfp558 A G 9: 18,456,373 M373T probably benign Het
Other mutations in Pot1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Pot1a APN 6 25744628 missense probably benign 0.01
IGL01393:Pot1a APN 6 25744631 nonsense probably null
IGL01411:Pot1a APN 6 25750144 splice site probably benign
IGL01774:Pot1a APN 6 25753277 missense probably benign 0.00
IGL01981:Pot1a APN 6 25750100 missense probably damaging 1.00
IGL02404:Pot1a APN 6 25764432 splice site probably benign
IGL02530:Pot1a APN 6 25794593 missense probably damaging 1.00
IGL02755:Pot1a APN 6 25771613 missense possibly damaging 0.81
IGL03127:Pot1a APN 6 25794616 missense probably benign 0.00
IGL03396:Pot1a APN 6 25745914 missense possibly damaging 0.93
BB001:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
BB011:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
R0329:Pot1a UTSW 6 25778831 splice site probably benign
R0359:Pot1a UTSW 6 25771680 splice site probably benign
R0530:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R0840:Pot1a UTSW 6 25748284 splice site probably benign
R0918:Pot1a UTSW 6 25756268 missense possibly damaging 0.92
R1650:Pot1a UTSW 6 25745965 missense probably damaging 1.00
R1937:Pot1a UTSW 6 25753324 missense probably benign 0.15
R2142:Pot1a UTSW 6 25750044 splice site probably null
R4072:Pot1a UTSW 6 25752357 splice site probably null
R4074:Pot1a UTSW 6 25752357 splice site probably null
R4322:Pot1a UTSW 6 25745930 missense probably benign 0.02
R4895:Pot1a UTSW 6 25753206 missense probably damaging 1.00
R4910:Pot1a UTSW 6 25746021 intron probably benign
R4933:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R5748:Pot1a UTSW 6 25758856 missense possibly damaging 0.77
R5775:Pot1a UTSW 6 25757298 splice site probably null
R5870:Pot1a UTSW 6 25778951 missense possibly damaging 0.90
R6180:Pot1a UTSW 6 25771621 missense probably benign 0.00
R6377:Pot1a UTSW 6 25778870 missense probably benign 0.06
R7251:Pot1a UTSW 6 25752498 splice site probably null
R7457:Pot1a UTSW 6 25771622 missense probably benign 0.26
R7679:Pot1a UTSW 6 25771634 missense probably benign 0.16
R7717:Pot1a UTSW 6 25758823 missense probably benign 0.45
R7924:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
R8078:Pot1a UTSW 6 25750108 missense probably benign 0.13
R8084:Pot1a UTSW 6 25771536 missense possibly damaging 0.81
R8170:Pot1a UTSW 6 25758803 makesense probably null
R9070:Pot1a UTSW 6 25744630 missense
Predicted Primers PCR Primer
(F):5'- TCTAGCTACTAATGAAGCCTGATAC -3'
(R):5'- CCTTGCTCATGTTAGGCAAAC -3'

Sequencing Primer
(F):5'- GAACAATGCAGCCTTCTTG -3'
(R):5'- GGCAAACATTTTTATTCCAATAGCCC -3'
Posted On 2016-10-06