Incidental Mutation 'R5543:Vamp3'
ID436087
Institutional Source Beutler Lab
Gene Symbol Vamp3
Ensembl Gene ENSMUSG00000028955
Gene Namevesicle-associated membrane protein 3
Synonymsceb, D130027G05Rik, VAMP-3, cellubrevin
MMRRC Submission 043101-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5543 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location151047300-151057963 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151051020 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 47 (L47P)
Ref Sequence ENSEMBL: ENSMUSP00000030797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030797] [ENSMUST00000169423]
Predicted Effect probably damaging
Transcript: ENSMUST00000030797
AA Change: L47P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030797
Gene: ENSMUSG00000028955
AA Change: L47P

DomainStartEndE-ValueType
Pfam:Synaptobrevin 15 103 4.2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155446
Predicted Effect probably benign
Transcript: ENSMUST00000169423
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. This gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Because of its high homology to other known VAMPs, its broad tissue distribution, and its subcellular localization, the protein encoded by this gene was shown to be the human equivalent of the rodent cellubrevin. In platelets the protein resides on a compartment that is not mobilized to the plasma membrane on calcium or thrombin stimulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation lack vesicle-associated membrane protein 3 but are apparently normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik C A 7: 128,237,181 S80I probably benign Het
Aak1 T C 6: 86,982,645 probably null Het
Abcc6 A G 7: 45,989,536 probably null Het
Acvr1 A G 2: 58,463,145 S268P probably damaging Het
Apod T C 16: 31,303,533 probably null Het
Atp5o T C 16: 91,926,530 I58V probably benign Het
AU040320 C T 4: 126,841,224 T777M probably damaging Het
BC067074 C A 13: 113,320,873 T1151K probably damaging Het
Ccne2 A T 4: 11,194,026 N89I probably benign Het
Dnah7a A G 1: 53,504,069 V2314A probably damaging Het
Dopey2 T C 16: 93,798,920 S1881P probably damaging Het
E4f1 A G 17: 24,447,362 V24A possibly damaging Het
Esrrg A T 1: 188,150,254 D236V probably damaging Het
Fam240b T A 13: 64,485,922 I27F possibly damaging Het
Fat1 T A 8: 45,023,479 I1854N probably damaging Het
Fchsd2 T C 7: 101,271,699 Y480H probably damaging Het
Fras1 A G 5: 96,528,535 N47S probably benign Het
Gabrr3 T C 16: 59,433,507 S196P probably damaging Het
Gbp8 T A 5: 105,017,830 D319V possibly damaging Het
Hrh3 G T 2: 180,103,970 A61E probably damaging Het
Idua T C 5: 108,670,229 I89T probably benign Het
Ifitm3 T A 7: 141,009,817 I108F unknown Het
Izumo4 T C 10: 80,702,834 F40S probably damaging Het
Kifc2 A G 15: 76,667,042 R679G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ldha A T 7: 46,850,890 I171F possibly damaging Het
Lrfn4 T C 19: 4,612,163 S609G probably benign Het
Mmp15 T C 8: 95,368,101 F201S possibly damaging Het
Myof C T 19: 37,981,330 V295I probably benign Het
Olfr1024 G T 2: 85,904,328 A242D probably damaging Het
Olfr30 T A 11: 58,455,167 M261L probably damaging Het
Olfr354 C T 2: 36,907,357 T137I possibly damaging Het
Parp14 T C 16: 35,834,767 D1778G probably benign Het
Pcnt A T 10: 76,412,052 D969E probably benign Het
Pibf1 A T 14: 99,112,992 N192I probably benign Het
Pitpnm3 A G 11: 72,056,197 F792S probably damaging Het
Pkd2 T A 5: 104,489,333 I604N probably damaging Het
Pla2g15 T C 8: 106,161,143 Y188H probably damaging Het
Plxnc1 G T 10: 94,864,774 D643E probably benign Het
Prrc2c G A 1: 162,673,511 P1241L probably damaging Het
Ptprd T C 4: 76,059,753 E173G probably damaging Het
Shank3 T C 15: 89,532,354 V232A probably damaging Het
Shbg A G 11: 69,616,738 I171T probably damaging Het
Slc22a14 A T 9: 119,173,608 F404L probably benign Het
Slc37a3 C A 6: 39,355,026 G158C probably damaging Het
Slfn9 C A 11: 82,982,381 L565F probably damaging Het
Tex43 G A 18: 56,594,688 probably benign Het
Trank1 T A 9: 111,366,112 M1068K probably damaging Het
Trbv15 A T 6: 41,141,253 I15L probably benign Het
Ttn C T 2: 76,739,574 V26992M probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b34 T A 5: 86,906,701 I74F probably damaging Het
Zfp143 T A 7: 110,083,315 C363* probably null Het
Zfp438 T C 18: 5,213,761 E399G probably damaging Het
Other mutations in Vamp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1882:Vamp3 UTSW 4 151050909 intron probably benign
R1944:Vamp3 UTSW 4 151056160 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTTGGCCAAGATTCTACCC -3'
(R):5'- TCCTTCTTAAGTGGAAGTTTAGCTC -3'

Sequencing Primer
(F):5'- GTTGGCCAAGATTCTACCCACTAC -3'
(R):5'- ACAAAGTGCCCATAGGTG -3'
Posted On2016-10-24