Incidental Mutation 'R5543:Ifitm3'
ID436103
Institutional Source Beutler Lab
Gene Symbol Ifitm3
Ensembl Gene ENSMUSG00000025492
Gene Nameinterferon induced transmembrane protein 3
Synonymsmil-1, Fgls, 1110004C05Rik, fragilis, IP15
MMRRC Submission 043101-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5543 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141009586-141010770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141009817 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 108 (I108F)
Ref Sequence ENSEMBL: ENSMUSP00000026565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026565]
Predicted Effect unknown
Transcript: ENSMUST00000026565
AA Change: I108F
SMART Domains Protein: ENSMUSP00000026565
Gene: ENSMUSG00000025492
AA Change: I108F

DomainStartEndE-ValueType
Pfam:CD225 47 130 7.6e-33 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an interferon-induced membrane protein that helps confer immunity to influenza A H1N1 virus, West Nile virus, and dengue virus. Two transcript variants, only one of them protein-coding, have been found for this gene. Another variant encoding an N-terminally truncated isoform has been reported, but the full-length nature of this variant has not been determined. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a reporter allele are viable and fertile with no detectable defects in embryogenesis or germ cell development but show increased susceptibility to respiratory syncytial virus and influenza A virus infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik C A 7: 128,237,181 S80I probably benign Het
Aak1 T C 6: 86,982,645 probably null Het
Abcc6 A G 7: 45,989,536 probably null Het
Acvr1 A G 2: 58,463,145 S268P probably damaging Het
Apod T C 16: 31,303,533 probably null Het
Atp5o T C 16: 91,926,530 I58V probably benign Het
AU040320 C T 4: 126,841,224 T777M probably damaging Het
BC067074 C A 13: 113,320,873 T1151K probably damaging Het
Ccne2 A T 4: 11,194,026 N89I probably benign Het
Dnah7a A G 1: 53,504,069 V2314A probably damaging Het
Dopey2 T C 16: 93,798,920 S1881P probably damaging Het
E4f1 A G 17: 24,447,362 V24A possibly damaging Het
Esrrg A T 1: 188,150,254 D236V probably damaging Het
Fam240b T A 13: 64,485,922 I27F possibly damaging Het
Fat1 T A 8: 45,023,479 I1854N probably damaging Het
Fchsd2 T C 7: 101,271,699 Y480H probably damaging Het
Fras1 A G 5: 96,528,535 N47S probably benign Het
Gabrr3 T C 16: 59,433,507 S196P probably damaging Het
Gbp8 T A 5: 105,017,830 D319V possibly damaging Het
Hrh3 G T 2: 180,103,970 A61E probably damaging Het
Idua T C 5: 108,670,229 I89T probably benign Het
Izumo4 T C 10: 80,702,834 F40S probably damaging Het
Kifc2 A G 15: 76,667,042 R679G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ldha A T 7: 46,850,890 I171F possibly damaging Het
Lrfn4 T C 19: 4,612,163 S609G probably benign Het
Mmp15 T C 8: 95,368,101 F201S possibly damaging Het
Myof C T 19: 37,981,330 V295I probably benign Het
Olfr1024 G T 2: 85,904,328 A242D probably damaging Het
Olfr30 T A 11: 58,455,167 M261L probably damaging Het
Olfr354 C T 2: 36,907,357 T137I possibly damaging Het
Parp14 T C 16: 35,834,767 D1778G probably benign Het
Pcnt A T 10: 76,412,052 D969E probably benign Het
Pibf1 A T 14: 99,112,992 N192I probably benign Het
Pitpnm3 A G 11: 72,056,197 F792S probably damaging Het
Pkd2 T A 5: 104,489,333 I604N probably damaging Het
Pla2g15 T C 8: 106,161,143 Y188H probably damaging Het
Plxnc1 G T 10: 94,864,774 D643E probably benign Het
Prrc2c G A 1: 162,673,511 P1241L probably damaging Het
Ptprd T C 4: 76,059,753 E173G probably damaging Het
Shank3 T C 15: 89,532,354 V232A probably damaging Het
Shbg A G 11: 69,616,738 I171T probably damaging Het
Slc22a14 A T 9: 119,173,608 F404L probably benign Het
Slc37a3 C A 6: 39,355,026 G158C probably damaging Het
Slfn9 C A 11: 82,982,381 L565F probably damaging Het
Tex43 G A 18: 56,594,688 probably benign Het
Trank1 T A 9: 111,366,112 M1068K probably damaging Het
Trbv15 A T 6: 41,141,253 I15L probably benign Het
Ttn C T 2: 76,739,574 V26992M probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b34 T A 5: 86,906,701 I74F probably damaging Het
Vamp3 A G 4: 151,051,020 L47P probably damaging Het
Zfp143 T A 7: 110,083,315 C363* probably null Het
Zfp438 T C 18: 5,213,761 E399G probably damaging Het
Other mutations in Ifitm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02039:Ifitm3 APN 7 141010650 utr 5 prime probably benign
IGL02478:Ifitm3 APN 7 141009874 missense possibly damaging 0.68
IGL02889:Ifitm3 APN 7 141009879 missense probably damaging 1.00
I0000:Ifitm3 UTSW 7 141010528 missense possibly damaging 0.85
R1069:Ifitm3 UTSW 7 141009900 splice site probably benign
R4019:Ifitm3 UTSW 7 141009859 missense possibly damaging 0.71
R4991:Ifitm3 UTSW 7 141010459 missense probably damaging 1.00
R5288:Ifitm3 UTSW 7 141010641 missense probably benign 0.00
R5385:Ifitm3 UTSW 7 141010641 missense probably benign 0.00
R5386:Ifitm3 UTSW 7 141010641 missense probably benign 0.00
R7071:Ifitm3 UTSW 7 141010524 missense probably benign 0.03
R7602:Ifitm3 UTSW 7 141010459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTTTATTGAATCCACTGTGG -3'
(R):5'- TGTTCCTGACCTAAGATGGGG -3'

Sequencing Primer
(F):5'- AAATGAGTGTTACACCTGCGTG -3'
(R):5'- TTCCTGACCTAAGATGGGGAGATG -3'
Posted On2016-10-24