Incidental Mutation 'R5597:Aebp1'
ID437886
Institutional Source Beutler Lab
Gene Symbol Aebp1
Ensembl Gene ENSMUSG00000020473
Gene NameAE binding protein 1
SynonymsACLP
MMRRC Submission 043149-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5597 (G1)
Quality Score207
Status Validated
Chromosome11
Chromosomal Location5861947-5872088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5866487 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 322 (V322A)
Ref Sequence ENSEMBL: ENSMUSP00000099987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102923] [ENSMUST00000109829]
Predicted Effect probably benign
Transcript: ENSMUST00000102923
AA Change: V322A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099987
Gene: ENSMUSG00000020473
AA Change: V322A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 46 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
low complexity region 113 159 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
low complexity region 264 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
FA58C 375 531 8.72e-46 SMART
Zn_pept 555 983 5.56e-43 SMART
low complexity region 1005 1029 N/A INTRINSIC
low complexity region 1035 1052 N/A INTRINSIC
low complexity region 1069 1089 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109829
SMART Domains Protein: ENSMUSP00000105454
Gene: ENSMUSG00000020473

DomainStartEndE-ValueType
FA58C 1 151 2.04e-37 SMART
Zn_pept 175 603 5.56e-43 SMART
low complexity region 625 649 N/A INTRINSIC
low complexity region 655 672 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138103
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of carboxypeptidase A protein family. The encoded protein may function as a transcriptional repressor and play a role in adipogenesis and smooth muscle cell differentiation. Studies in mice suggest that this gene functions in wound healing and abdominal wall development. Overexpression of this gene is associated with glioblastoma. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for one null allele exhibit neonatal lethality, abdominal wall herniation, extrusion of the abdominal organs, and defects in wound healing. Mice homozygous for another null allele exhibit embryonic lethality, decreased white adipose tissue, and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G A 11: 110,036,537 T1330I probably damaging Het
Anks3 T A 16: 4,953,929 H77L possibly damaging Het
Bsn A T 9: 108,114,932 M1207K probably benign Het
Btla A G 16: 45,244,236 T183A probably benign Het
Cdca8 G A 4: 124,919,000 R286W probably damaging Het
Cnot6l T C 5: 96,131,119 D80G probably damaging Het
Col16a1 A G 4: 130,058,304 D93G probably damaging Het
Ctsk T C 3: 95,501,696 V130A probably damaging Het
Cul9 T C 17: 46,502,665 E2294G possibly damaging Het
Dcaf5 G T 12: 80,340,043 S436R probably damaging Het
Dnah7a A T 1: 53,534,452 L1792H probably benign Het
Dst T C 1: 34,192,713 V3307A probably benign Het
Frrs1 C T 3: 116,878,238 probably benign Het
Gimap4 T C 6: 48,690,764 L151P probably damaging Het
Gm9268 A G 7: 43,024,649 D377G probably benign Het
Hook2 A G 8: 84,994,028 N166S probably benign Het
Hp1bp3 A T 4: 138,221,628 M1L possibly damaging Het
Igkv4-56 T A 6: 69,587,483 noncoding transcript Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Lamc1 A G 1: 153,251,970 C396R probably damaging Het
Lars2 A T 9: 123,454,982 D745V probably damaging Het
Macf1 A T 4: 123,539,777 probably benign Het
Mapk4 T A 18: 73,937,270 Y184F probably benign Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Msh2 T C 17: 87,723,361 S889P probably benign Het
Nebl A G 2: 17,378,167 S100P probably benign Het
Nudt7 A T 8: 114,151,766 H154L probably benign Het
Olfr1018 T C 2: 85,823,460 L163P probably damaging Het
Olfr192 A T 16: 59,098,347 V215D unknown Het
Olfr807 T C 10: 129,754,886 D188G probably damaging Het
Olig2 A T 16: 91,226,880 M161L probably benign Het
Palmd T A 3: 116,923,576 D424V probably damaging Het
Pdzk1ip1 A G 4: 115,093,492 N164D probably damaging Het
Prkag1 A G 15: 98,815,908 S14P probably damaging Het
Prss12 C T 3: 123,464,740 P161L probably benign Het
Pwwp2a T C 11: 43,682,595 V168A probably benign Het
Rassf7 A G 7: 141,217,111 D79G probably damaging Het
Rgs3 A T 4: 62,623,845 I19F probably damaging Het
Slc30a10 C A 1: 185,462,700 H236Q probably damaging Het
Slco3a1 C A 7: 74,284,462 R654L probably benign Het
Smad4 A C 18: 73,662,827 F165L probably benign Het
Swsap1 G T 9: 21,955,946 R62M probably damaging Het
Tenm4 T A 7: 96,553,517 M113K probably benign Het
Tmem225 A G 9: 40,149,430 N95S possibly damaging Het
Tnni3k A T 3: 154,872,128 L658H probably damaging Het
Trem2 G A 17: 48,351,812 V202I probably benign Het
Tyw1 C T 5: 130,274,657 L289F probably benign Het
Vcam1 T A 3: 116,126,002 D205V probably damaging Het
Yy1 A G 12: 108,815,510 D367G probably damaging Het
Zfp11 A T 5: 129,657,102 C432S probably benign Het
Other mutations in Aebp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Aebp1 APN 11 5871787 missense possibly damaging 0.67
IGL01464:Aebp1 APN 11 5869822 missense possibly damaging 0.46
IGL01561:Aebp1 APN 11 5871349 missense probably damaging 1.00
IGL01648:Aebp1 APN 11 5870607 missense possibly damaging 0.96
IGL01950:Aebp1 APN 11 5869108 missense probably benign 0.02
IGL02094:Aebp1 APN 11 5868357 missense probably benign 0.17
IGL02585:Aebp1 APN 11 5870855 splice site probably null
R0006:Aebp1 UTSW 11 5863935 unclassified probably benign
R0551:Aebp1 UTSW 11 5867955 missense probably benign 0.04
R1144:Aebp1 UTSW 11 5868475 missense probably benign 0.17
R1265:Aebp1 UTSW 11 5871740 missense probably damaging 0.98
R1297:Aebp1 UTSW 11 5870834 missense possibly damaging 0.69
R1518:Aebp1 UTSW 11 5871469 missense possibly damaging 0.58
R1524:Aebp1 UTSW 11 5870089 missense probably damaging 0.98
R2567:Aebp1 UTSW 11 5870251 missense probably benign 0.29
R3155:Aebp1 UTSW 11 5871425 missense probably benign 0.16
R4415:Aebp1 UTSW 11 5865451 missense probably damaging 0.96
R4507:Aebp1 UTSW 11 5870565 missense probably damaging 1.00
R5248:Aebp1 UTSW 11 5868501 missense possibly damaging 0.63
R5809:Aebp1 UTSW 11 5870257 missense probably benign
R5919:Aebp1 UTSW 11 5871421 missense probably benign 0.00
R5982:Aebp1 UTSW 11 5867911 missense possibly damaging 0.69
R6139:Aebp1 UTSW 11 5871842 missense probably damaging 1.00
R7067:Aebp1 UTSW 11 5866431 critical splice acceptor site probably null
R7289:Aebp1 UTSW 11 5865059 missense probably damaging 1.00
R7383:Aebp1 UTSW 11 5868548 missense probably damaging 1.00
R7437:Aebp1 UTSW 11 5869757 missense possibly damaging 0.50
Z1088:Aebp1 UTSW 11 5871460 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATTCTTCCTCCCCATAGGCAG -3'
(R):5'- GCTAAGCTAGGGATACATGGGTC -3'

Sequencing Primer
(F):5'- TACTAGGCTTGTGACCTC -3'
(R):5'- GATACATGGGTCAGGCTGAC -3'
Posted On2016-10-26