Mutagenetix > Incidental Mutations

Incidental Mutation 'R5597:Aebp1'

437886

Institutional Source

Beutler Lab

Gene Symbol

Aebp1

Ensembl Gene

ENSMUSG00000020473

Gene Name

AE binding protein 1

Synonyms

ACLP

MMRRC Submission

043149-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5597 (G1)

Quality Score

207

Status

Validated

Chromosome

Chromosomal Location

5861947-5872088 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5866487 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 322 (V322A)

Ref Sequence

ENSEMBL: ENSMUSP00000099987 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102923] [ENSMUST00000109829]

Predicted Effect

probably benign
Transcript: ENSMUST00000102923
AA Change: V322A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000099987
Gene: ENSMUSG00000020473
AA Change: V322A

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	33	46	N/A	INTRINSIC
low complexity region	85	102	N/A	INTRINSIC
low complexity region	113	159	N/A	INTRINSIC
low complexity region	217	229	N/A	INTRINSIC
low complexity region	264	290	N/A	INTRINSIC
low complexity region	324	341	N/A	INTRINSIC
FA58C	375	531	8.72e-46	SMART
Zn_pept	555	983	5.56e-43	SMART
low complexity region	1005	1029	N/A	INTRINSIC
low complexity region	1035	1052	N/A	INTRINSIC
low complexity region	1069	1089	N/A	INTRINSIC
low complexity region	1092	1106	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109829

SMART Domains

Protein: ENSMUSP00000105454
Gene: ENSMUSG00000020473

Domain	Start	End	E-Value	Type
FA58C	1	151	2.04e-37	SMART
Zn_pept	175	603	5.56e-43	SMART
low complexity region	625	649	N/A	INTRINSIC
low complexity region	655	672	N/A	INTRINSIC
low complexity region	689	709	N/A	INTRINSIC
low complexity region	712	726	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138103

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of carboxypeptidase A protein family. The encoded protein may function as a transcriptional repressor and play a role in adipogenesis and smooth muscle cell differentiation. Studies in mice suggest that this gene functions in wound healing and abdominal wall development. Overexpression of this gene is associated with glioblastoma. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for one null allele exhibit neonatal lethality, abdominal wall herniation, extrusion of the abdominal organs, and defects in wound healing. Mice homozygous for another null allele exhibit embryonic lethality, decreased white adipose tissue, and resistance to diet-induced obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	G	A	11: 110,036,537	T1330I	probably damaging	Het
Anks3	T	A	16: 4,953,929	H77L	possibly damaging	Het
Bsn	A	T	9: 108,114,932	M1207K	probably benign	Het
Btla	A	G	16: 45,244,236	T183A	probably benign	Het
Cdca8	G	A	4: 124,919,000	R286W	probably damaging	Het
Cnot6l	T	C	5: 96,131,119	D80G	probably damaging	Het
Col16a1	A	G	4: 130,058,304	D93G	probably damaging	Het
Ctsk	T	C	3: 95,501,696	V130A	probably damaging	Het
Cul9	T	C	17: 46,502,665	E2294G	possibly damaging	Het
Dcaf5	G	T	12: 80,340,043	S436R	probably damaging	Het
Dnah7a	A	T	1: 53,534,452	L1792H	probably benign	Het
Dst	T	C	1: 34,192,713	V3307A	probably benign	Het
Frrs1	C	T	3: 116,878,238		probably benign	Het
Gimap4	T	C	6: 48,690,764	L151P	probably damaging	Het
Gm9268	A	G	7: 43,024,649	D377G	probably benign	Het
Hook2	A	G	8: 84,994,028	N166S	probably benign	Het
Hp1bp3	A	T	4: 138,221,628	M1L	possibly damaging	Het
Igkv4-56	T	A	6: 69,587,483		noncoding transcript	Het
Kdm6b	C	T	11: 69,406,074	A456T	probably damaging	Het
Lamc1	A	G	1: 153,251,970	C396R	probably damaging	Het
Lars2	A	T	9: 123,454,982	D745V	probably damaging	Het
Macf1	A	T	4: 123,539,777		probably benign	Het
Mapk4	T	A	18: 73,937,270	Y184F	probably benign	Het
Mgat5	A	G	1: 127,397,566	Y390C	probably damaging	Het
Msh2	T	C	17: 87,723,361	S889P	probably benign	Het
Nebl	A	G	2: 17,378,167	S100P	probably benign	Het
Nudt7	A	T	8: 114,151,766	H154L	probably benign	Het
Olfr1018	T	C	2: 85,823,460	L163P	probably damaging	Het
Olfr192	A	T	16: 59,098,347	V215D	unknown	Het
Olfr807	T	C	10: 129,754,886	D188G	probably damaging	Het
Olig2	A	T	16: 91,226,880	M161L	probably benign	Het
Palmd	T	A	3: 116,923,576	D424V	probably damaging	Het
Pdzk1ip1	A	G	4: 115,093,492	N164D	probably damaging	Het
Prkag1	A	G	15: 98,815,908	S14P	probably damaging	Het
Prss12	C	T	3: 123,464,740	P161L	probably benign	Het
Pwwp2a	T	C	11: 43,682,595	V168A	probably benign	Het
Rassf7	A	G	7: 141,217,111	D79G	probably damaging	Het
Rgs3	A	T	4: 62,623,845	I19F	probably damaging	Het
Slc30a10	C	A	1: 185,462,700	H236Q	probably damaging	Het
Slco3a1	C	A	7: 74,284,462	R654L	probably benign	Het
Smad4	A	C	18: 73,662,827	F165L	probably benign	Het
Swsap1	G	T	9: 21,955,946	R62M	probably damaging	Het
Tenm4	T	A	7: 96,553,517	M113K	probably benign	Het
Tmem225	A	G	9: 40,149,430	N95S	possibly damaging	Het
Tnni3k	A	T	3: 154,872,128	L658H	probably damaging	Het
Trem2	G	A	17: 48,351,812	V202I	probably benign	Het
Tyw1	C	T	5: 130,274,657	L289F	probably benign	Het
Vcam1	T	A	3: 116,126,002	D205V	probably damaging	Het
Yy1	A	G	12: 108,815,510	D367G	probably damaging	Het
Zfp11	A	T	5: 129,657,102	C432S	probably benign	Het

Other mutations in Aebp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00578:Aebp1	APN	11	5871787	missense	possibly damaging	0.67
IGL01464:Aebp1	APN	11	5869822	missense	possibly damaging	0.46
IGL01561:Aebp1	APN	11	5871349	missense	probably damaging	1.00
IGL01648:Aebp1	APN	11	5870607	missense	possibly damaging	0.96
IGL01950:Aebp1	APN	11	5869108	missense	probably benign	0.02
IGL02094:Aebp1	APN	11	5868357	missense	probably benign	0.17
IGL02585:Aebp1	APN	11	5870855	splice site	probably null
R0006:Aebp1	UTSW	11	5863935	unclassified	probably benign
R0551:Aebp1	UTSW	11	5867955	missense	probably benign	0.04
R1144:Aebp1	UTSW	11	5868475	missense	probably benign	0.17
R1265:Aebp1	UTSW	11	5871740	missense	probably damaging	0.98
R1297:Aebp1	UTSW	11	5870834	missense	possibly damaging	0.69
R1518:Aebp1	UTSW	11	5871469	missense	possibly damaging	0.58
R1524:Aebp1	UTSW	11	5870089	missense	probably damaging	0.98
R2567:Aebp1	UTSW	11	5870251	missense	probably benign	0.29
R3155:Aebp1	UTSW	11	5871425	missense	probably benign	0.16
R4415:Aebp1	UTSW	11	5865451	missense	probably damaging	0.96
R4507:Aebp1	UTSW	11	5870565	missense	probably damaging	1.00
R5248:Aebp1	UTSW	11	5868501	missense	possibly damaging	0.63
R5809:Aebp1	UTSW	11	5870257	missense	probably benign
R5919:Aebp1	UTSW	11	5871421	missense	probably benign	0.00
R5982:Aebp1	UTSW	11	5867911	missense	possibly damaging	0.69
R6139:Aebp1	UTSW	11	5871842	missense	probably damaging	1.00
R7067:Aebp1	UTSW	11	5866431	critical splice acceptor site	probably null
R7289:Aebp1	UTSW	11	5865059	missense	probably damaging	1.00
R7383:Aebp1	UTSW	11	5868548	missense	probably damaging	1.00
R7437:Aebp1	UTSW	11	5869757	missense	possibly damaging	0.50
Z1088:Aebp1	UTSW	11	5871460	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GATTCTTCCTCCCCATAGGCAG -3'
(R):5'- GCTAAGCTAGGGATACATGGGTC -3'

Sequencing Primer
(F):5'- TACTAGGCTTGTGACCTC -3'
(R):5'- GATACATGGGTCAGGCTGAC -3'

Posted On

2016-10-26