Incidental Mutation 'R0157:Pcdh10'
ID22894
Institutional Source Beutler Lab
Gene Symbol Pcdh10
Ensembl Gene ENSMUSG00000049100
Gene Nameprotocadherin 10
Synonyms6430521D13Rik, OL-pc, 6430703F07Rik
MMRRC Submission 038437-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R0157 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location45378398-45435623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45379701 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 150 (D150G)
Ref Sequence ENSEMBL: ENSMUSP00000141529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166126] [ENSMUST00000170695] [ENSMUST00000171554] [ENSMUST00000193252]
Predicted Effect probably damaging
Transcript: ENSMUST00000166126
AA Change: D150G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131073
Gene: ENSMUSG00000049100
AA Change: D150G

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
Pfam:Cadherin_C_2 713 838 5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170695
AA Change: D150G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132769
Gene: ENSMUSG00000049100
AA Change: D150G

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171554
AA Change: D150G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131600
Gene: ENSMUSG00000049100
AA Change: D150G

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191843
Predicted Effect probably damaging
Transcript: ENSMUST00000193252
AA Change: D150G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141529
Gene: ENSMUSG00000049100
AA Change: D150G

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195655
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.5%
Validation Efficiency 64% (47/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This family member contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein is a cadherin-related neuronal receptor thought to function in the establishment of specific cell-cell connections in the brain. This gene plays a role in inhibiting cancer cell motility and cell migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele die within several weeks of birth and exhibit decreased body size and defective striatal axon growth and thalamocortical projections in the ventral telencephalon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T A 11: 80,165,701 I180N probably damaging Het
Alk T A 17: 71,949,845 N673I probably benign Het
Ankrd7 T C 6: 18,866,540 S20P probably damaging Het
Arhgef26 T G 3: 62,380,971 D487E probably damaging Het
Arhgef4 A G 1: 34,806,394 D1500G probably damaging Het
Arhgef7 A G 8: 11,785,812 I39V probably damaging Het
Asap2 T A 12: 21,206,325 I208N probably damaging Het
Atad5 T C 11: 80,089,817 V16A possibly damaging Het
Atp2b1 T C 10: 98,999,947 I518T probably damaging Het
B130006D01Rik T C 11: 95,726,385 probably benign Het
BC028528 A G 3: 95,884,968 probably null Het
Bpifb6 T A 2: 153,903,966 L74Q probably benign Het
Bptf T C 11: 107,074,658 T1122A possibly damaging Het
Cacna2d4 T A 6: 119,312,424 D806E probably benign Het
Cdhr3 T C 12: 33,061,650 Q287R possibly damaging Het
Cdk12 A G 11: 98,249,776 probably benign Het
Cenpf T A 1: 189,652,359 T2575S probably benign Het
Chd7 T A 4: 8,833,759 I1171N probably damaging Het
Chd9 T C 8: 91,008,836 probably null Het
Ckmt1 A G 2: 121,363,041 T361A possibly damaging Het
Clec4d G T 6: 123,267,136 R68L probably benign Het
Csmd2 G T 4: 128,521,911 V2678F probably benign Het
Cul7 T A 17: 46,653,835 V131E possibly damaging Het
Dab2 T C 15: 6,429,827 S407P probably benign Het
Dnah17 C T 11: 118,127,171 G166D probably benign Het
F13b G A 1: 139,503,847 V52I probably benign Het
Fam208b C A 13: 3,575,550 V1467L probably benign Het
Gjd4 T C 18: 9,280,549 I176M probably benign Het
Gm13083 C T 4: 143,615,796 P158S probably damaging Het
Gm4969 T C 7: 19,107,020 H63R possibly damaging Het
Hoxc11 A G 15: 102,955,001 Y159C probably damaging Het
Hydin T C 8: 110,300,010 I120T possibly damaging Het
Il20rb A G 9: 100,473,079 Y104H probably damaging Het
Krtap21-1 A G 16: 89,403,542 C71R unknown Het
Lamc1 T C 1: 153,262,607 D167G probably benign Het
Lin7c C A 2: 109,895,169 A73E probably damaging Het
Mms22l C A 4: 24,588,224 A952E probably damaging Het
Myh3 A G 11: 67,082,909 N136S probably benign Het
Ndufb10 T C 17: 24,724,244 T31A probably benign Het
Nlrp2 T C 7: 5,308,770 Y37C possibly damaging Het
Olfr1384 T C 11: 49,513,773 I45T probably damaging Het
Olfr314 T C 11: 58,787,059 F275S probably damaging Het
Orc3 C A 4: 34,607,130 probably null Het
Pard3b A C 1: 62,211,633 M512L probably damaging Het
Pcolce A T 5: 137,610,479 probably null Het
Pdcl A C 2: 37,352,177 I187S probably damaging Het
Pkn1 T C 8: 83,692,820 I51M probably damaging Het
Pla2g4e T A 2: 120,170,181 T692S probably benign Het
Plcb2 C A 2: 118,718,541 V380F probably damaging Het
Pmpcb A T 5: 21,742,952 I218F probably damaging Het
Pms1 A T 1: 53,195,037 Y773* probably null Het
Polr2e C T 10: 80,036,781 G184R probably damaging Het
Polr3a T C 14: 24,479,186 I369V probably damaging Het
Prpf4b T C 13: 34,884,031 probably benign Het
Pzp G A 6: 128,523,976 Q140* probably null Het
Qrich2 T A 11: 116,441,395 E2325V probably damaging Het
R3hdm2 T G 10: 127,471,989 L373R probably damaging Het
Sema3d A T 5: 12,508,137 D212V possibly damaging Het
Sidt2 A G 9: 45,939,267 I850T probably damaging Het
Slc22a29 C T 19: 8,162,742 R433H possibly damaging Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sox21 G A 14: 118,235,942 probably benign Het
Steap3 A G 1: 120,227,649 *527R probably null Het
Svep1 T C 4: 58,069,830 E2652G possibly damaging Het
Taar2 T A 10: 23,941,491 F310I probably damaging Het
Tecta A G 9: 42,375,011 V783A probably benign Het
Vmn1r173 T A 7: 23,702,397 I19N probably damaging Het
Vwa5b1 T A 4: 138,604,879 M276L probably benign Het
Yeats2 A C 16: 20,221,677 *142C probably null Het
Zfp26 G T 9: 20,437,870 T466K probably benign Het
Zfp426 T C 9: 20,471,136 N171S probably benign Het
Other mutations in Pcdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Pcdh10 APN 3 45380302 missense probably damaging 1.00
IGL01115:Pcdh10 APN 3 45392775 missense probably damaging 1.00
IGL01535:Pcdh10 APN 3 45379643 missense probably damaging 1.00
IGL01600:Pcdh10 APN 3 45379487 missense probably damaging 0.98
IGL01625:Pcdh10 APN 3 45379397 missense probably damaging 0.99
IGL01966:Pcdh10 APN 3 45380298 missense probably benign 0.05
IGL02232:Pcdh10 APN 3 45380942 missense probably benign 0.00
IGL02490:Pcdh10 APN 3 45380487 missense probably damaging 1.00
IGL02890:Pcdh10 APN 3 45392617 missense probably damaging 1.00
IGL02976:Pcdh10 APN 3 45380013 missense possibly damaging 0.92
IGL02997:Pcdh10 APN 3 45379362 missense probably damaging 1.00
IGL03006:Pcdh10 APN 3 45379502 missense probably damaging 0.99
IGL03385:Pcdh10 APN 3 45381512 missense possibly damaging 0.77
R0025:Pcdh10 UTSW 3 45380499 missense possibly damaging 0.93
R0372:Pcdh10 UTSW 3 45379497 missense probably damaging 1.00
R0652:Pcdh10 UTSW 3 45379764 missense probably damaging 1.00
R0760:Pcdh10 UTSW 3 45380570 missense probably benign 0.19
R0976:Pcdh10 UTSW 3 45380801 missense probably damaging 1.00
R1307:Pcdh10 UTSW 3 45381879 missense probably benign 0.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1510:Pcdh10 UTSW 3 45379403 missense probably damaging 1.00
R1619:Pcdh10 UTSW 3 45380312 missense possibly damaging 0.94
R1678:Pcdh10 UTSW 3 45381881 nonsense probably null
R1687:Pcdh10 UTSW 3 45380015 missense probably damaging 1.00
R1750:Pcdh10 UTSW 3 45381881 nonsense probably null
R1751:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1767:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1857:Pcdh10 UTSW 3 45379937 missense possibly damaging 0.86
R2086:Pcdh10 UTSW 3 45380471 missense probably damaging 0.98
R3960:Pcdh10 UTSW 3 45379314 missense probably benign
R4083:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4084:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4112:Pcdh10 UTSW 3 45381620 missense probably damaging 1.00
R4754:Pcdh10 UTSW 3 45380637 missense probably damaging 0.99
R4946:Pcdh10 UTSW 3 45379482 missense probably damaging 1.00
R5039:Pcdh10 UTSW 3 45381861 missense probably damaging 1.00
R5224:Pcdh10 UTSW 3 45392814 missense probably damaging 0.99
R5233:Pcdh10 UTSW 3 45384191 missense probably damaging 1.00
R5261:Pcdh10 UTSW 3 45381812 missense probably damaging 1.00
R5429:Pcdh10 UTSW 3 45384200 missense probably benign 0.00
R5488:Pcdh10 UTSW 3 45381368 missense probably damaging 1.00
R5558:Pcdh10 UTSW 3 45384168 missense probably damaging 1.00
R5784:Pcdh10 UTSW 3 45380640 missense probably damaging 1.00
R5815:Pcdh10 UTSW 3 45392721 missense probably benign 0.04
R6283:Pcdh10 UTSW 3 45381554 missense possibly damaging 0.46
R6396:Pcdh10 UTSW 3 45380060 missense possibly damaging 0.46
R6703:Pcdh10 UTSW 3 45381299 missense possibly damaging 0.87
R6756:Pcdh10 UTSW 3 45380106 missense possibly damaging 0.80
R6968:Pcdh10 UTSW 3 45379542 missense probably damaging 1.00
R7463:Pcdh10 UTSW 3 45383572 missense possibly damaging 0.59
R7574:Pcdh10 UTSW 3 45381375 missense possibly damaging 0.92
R7691:Pcdh10 UTSW 3 45381197 missense probably damaging 1.00
R7795:Pcdh10 UTSW 3 45380222 missense probably benign 0.09
X0013:Pcdh10 UTSW 3 45379566 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGCAAATCTGTAAGCAGAGCCC -3'
(R):5'- ACATTGTCGTTGGAGTCGAGCAC -3'

Sequencing Primer
(F):5'- TAAGCAGAGCCCCTCTTGTG -3'
(R):5'- cctccccctccttcccc -3'
Posted On2013-04-16