Incidental Mutation 'R5832:Patz1'
ID449367
Institutional Source Beutler Lab
Gene Symbol Patz1
Ensembl Gene ENSMUSG00000020453
Gene NamePOZ (BTB) and AT hook containing zinc finger 1
SynonymsMAZR, POZ-AT hook-zinc finger protein, 8430401L15Rik, Zfp278
MMRRC Submission 044054-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R5832 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3288874-3309083 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3306277 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 521 (P521L)
Ref Sequence ENSEMBL: ENSMUSP00000105670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057089] [ENSMUST00000093402] [ENSMUST00000110043] [ENSMUST00000134089] [ENSMUST00000154319]
Predicted Effect probably benign
Transcript: ENSMUST00000057089
SMART Domains Protein: ENSMUSP00000050684
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
BTB 41 160 7.97e-24 SMART
low complexity region 209 224 N/A INTRINSIC
AT_hook 264 276 1.74e-1 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
AT_hook 345 357 2.82e2 SMART
ZnF_C2H2 355 377 8.94e-3 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 413 436 3.39e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 468 489 2.01e1 SMART
ZnF_C2H2 559 582 1.98e-4 SMART
low complexity region 585 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093402
SMART Domains Protein: ENSMUSP00000091103
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
BTB 41 160 7.97e-24 SMART
low complexity region 209 224 N/A INTRINSIC
AT_hook 264 276 1.74e-1 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
AT_hook 345 357 2.82e2 SMART
ZnF_C2H2 355 377 8.94e-3 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 413 436 3.39e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 468 489 2.01e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101644
Predicted Effect probably benign
Transcript: ENSMUST00000110043
AA Change: P521L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105670
Gene: ENSMUSG00000020453
AA Change: P521L

DomainStartEndE-ValueType
BTB 41 160 7.97e-24 SMART
low complexity region 209 224 N/A INTRINSIC
AT_hook 264 276 1.74e-1 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
AT_hook 345 357 2.82e2 SMART
ZnF_C2H2 355 377 8.94e-3 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 413 436 3.39e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 468 489 2.01e1 SMART
ZnF_C2H2 495 517 1.26e-2 SMART
Pfam:zf-C2H2_assoc3 536 604 6.5e-36 PFAM
ZnF_C2H2 605 628 1.98e-4 SMART
low complexity region 631 644 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123983
Predicted Effect probably benign
Transcript: ENSMUST00000134089
SMART Domains Protein: ENSMUSP00000138522
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
ZnF_C2H2 5 29 2.82e0 SMART
ZnF_C2H2 33 54 2.01e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152576
Predicted Effect probably benign
Transcript: ENSMUST00000154319
SMART Domains Protein: ENSMUSP00000122832
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
ZnF_C2H2 6 25 5.68e1 SMART
ZnF_C2H2 29 50 2.01e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155332
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an A-T hook DNA binding motif which usually binds to other DNA binding structures to play an important role in chromatin modeling and transcription regulation. Its Poz domain is thought to function as a site for protein-protein interaction and is required for transcriptional repression, and the zinc-fingers comprise the DNA binding domain. Since the encoded protein has typical features of a transcription factor, it is postulated to be a repressor of gene expression. In small round cell sarcoma, this gene is fused to EWS by a small inversion of 22q, then the hybrid is thought to be translocated (t(1;22)(p36.1;q12). The rearrangement of chromosome 22 involves intron 8 of EWS and exon 1 of this gene creating a chimeric sequence containing the transactivation domain of EWS fused to zinc finger domain of this protein. This is a distinct example of an intra-chromosomal rearrangement of chromosome 22. Four alternatively spliced transcript variants are described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic and fetal lethality, exencephaly, nervous system defects, outflow defects, transposition of great arteries, postnatal growth retardation and male and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adgrv1 G A 13: 81,103,302 S6232F possibly damaging Het
Alox12 T C 11: 70,253,280 E129G probably damaging Het
Anxa13 C A 15: 58,341,993 noncoding transcript Het
Arfgef3 C T 10: 18,630,420 G878D probably damaging Het
Asnsd1 T C 1: 53,347,475 D331G probably damaging Het
Crisp1 A G 17: 40,301,317 probably null Het
Eml5 T C 12: 98,876,188 N217S probably benign Het
Fat1 A T 8: 45,017,423 Y1463F possibly damaging Het
Fhod3 T C 18: 25,090,695 W1033R probably damaging Het
Galr2 T A 11: 116,281,631 L49Q probably damaging Het
Gstm5 T C 3: 107,897,537 V115A probably benign Het
Gtpbp2 C T 17: 46,167,862 T535I probably damaging Het
Hk1 T C 10: 62,292,365 E326G probably benign Het
Igfn1 A G 1: 135,974,795 V388A probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kitl C A 10: 100,080,020 P137H probably damaging Het
Lamp3 A T 16: 19,701,320 Y38N probably damaging Het
Lmo7 A T 14: 101,884,213 N5I probably damaging Het
Mc3r T A 2: 172,249,430 C191S probably benign Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mybpc3 A G 2: 91,119,175 probably null Het
Nav2 A T 7: 49,548,069 probably null Het
Pramef17 A G 4: 143,991,962 S304P probably damaging Het
Prkcd T C 14: 30,605,821 T103A probably damaging Het
Pttg1ip T C 10: 77,584,025 probably null Het
Rcbtb2 C A 14: 73,166,822 Q85K possibly damaging Het
Rdh16f1 T A 10: 127,788,749 V152E probably damaging Het
Rsph4a A G 10: 33,909,502 I470V probably benign Het
Sarnp T C 10: 128,848,312 probably null Het
Slc39a6 C A 18: 24,601,612 V7L possibly damaging Het
Slco1a4 A G 6: 141,819,544 I324T probably benign Het
Spata31d1a A T 13: 59,701,566 V916E probably damaging Het
Srgap1 T G 10: 121,840,914 T392P probably damaging Het
Tbc1d20 A T 2: 152,311,362 M271L possibly damaging Het
Tbc1d22b T C 17: 29,570,647 I161T possibly damaging Het
Tcof1 G T 18: 60,819,539 N918K unknown Het
Tnr A G 1: 159,886,122 T707A probably benign Het
Trim66 A G 7: 109,455,202 F1267S probably damaging Het
Trpm6 A G 19: 18,786,819 H263R possibly damaging Het
Tshz2 T A 2: 169,884,045 V187D possibly damaging Het
Ube2f T G 1: 91,285,324 V176G possibly damaging Het
Vmn2r109 C T 17: 20,541,056 A680T probably benign Het
Vmn2r77 T A 7: 86,811,462 C665* probably null Het
Zfp954 A G 7: 7,115,390 V385A probably damaging Het
Other mutations in Patz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Patz1 APN 11 3291134 missense probably damaging 1.00
IGL02954:Patz1 APN 11 3291761 missense probably damaging 1.00
IGL02981:Patz1 APN 11 3290656 missense probably damaging 1.00
R0153:Patz1 UTSW 11 3293288 missense probably damaging 1.00
R0758:Patz1 UTSW 11 3290879 missense probably damaging 1.00
R1680:Patz1 UTSW 11 3307812 missense probably damaging 0.96
R1954:Patz1 UTSW 11 3291088 missense probably damaging 0.99
R4610:Patz1 UTSW 11 3306241 missense probably damaging 1.00
R4964:Patz1 UTSW 11 3307720 missense probably damaging 1.00
R7172:Patz1 UTSW 11 3308032 missense probably benign
R7454:Patz1 UTSW 11 3298297 start gained probably benign
R8026:Patz1 UTSW 11 3307658 missense probably benign 0.00
R8047:Patz1 UTSW 11 3306283 missense probably benign
Z1177:Patz1 UTSW 11 3291751 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATGGCCTCATGTGATGATTGC -3'
(R):5'- GAGAGCACTGCGATTCTTGC -3'

Sequencing Primer
(F):5'- GCAGATGCTTTTGAGCCAAG -3'
(R):5'- ACTGCGATTCTTGCCTCCC -3'
Posted On2016-12-20