Incidental Mutation 'R5828:St14'
ID450271
Institutional Source Beutler Lab
Gene Symbol St14
Ensembl Gene ENSMUSG00000031995
Gene Namesuppression of tumorigenicity 14 (colon carcinoma)
SynonymsMT-SP1, matriptase, Tmprss14, Prss14, Epithin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5828 (G1)
Quality Score200
Status Validated
Chromosome9
Chromosomal Location31089402-31131853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31091507 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 700 (H700L)
Ref Sequence ENSEMBL: ENSMUSP00000034478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034478]
Predicted Effect probably damaging
Transcript: ENSMUST00000034478
AA Change: H700L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034478
Gene: ENSMUSG00000031995
AA Change: H700L

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
Pfam:SEA 88 181 7.9e-17 PFAM
CUB 214 334 4.24e-14 SMART
CUB 340 447 4.37e-25 SMART
LDLa 452 486 2.31e-9 SMART
LDLa 487 523 4.08e-10 SMART
LDLa 524 561 3.98e-13 SMART
LDLa 566 604 1.48e-7 SMART
Tryp_SPc 614 849 1.25e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119589
Meta Mutation Damage Score 0.406 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus results in pleiotropic defects affecting the development of the epidermis, hair follicles, and immune system. Mutant mice become dehydrated due to impaired epidermal barrier function and die within days of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,601,800 D95G unknown Het
Arl10 T A 13: 54,578,955 V182E probably damaging Het
Cacna1g T G 11: 94,457,154 S703R probably damaging Het
Ces2a C A 8: 104,739,324 T363N probably benign Het
Col14a1 G A 15: 55,436,976 V967I unknown Het
Col22a1 A T 15: 72,009,491 F4I probably benign Het
D630045J12Rik A G 6: 38,196,367 W289R possibly damaging Het
Disc1 A G 8: 125,251,024 Q793R probably damaging Het
Dnhd1 C T 7: 105,720,181 T4337I probably benign Het
Eif2b5 T A 16: 20,502,786 V363D possibly damaging Het
Emsy T C 7: 98,593,492 T1147A probably benign Het
Epg5 T A 18: 78,020,851 Y2048N probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Foxred1 A G 9: 35,210,196 probably benign Het
Gpaa1 T C 15: 76,332,271 probably benign Het
Gria4 A C 9: 4,432,832 L784V probably damaging Het
Homer3 A G 8: 70,286,306 Y105C probably benign Het
Hpgd T C 8: 56,319,071 S193P probably benign Het
Irf1 T A 11: 53,775,936 W247R probably benign Het
Lpgat1 A G 1: 191,776,382 Q344R possibly damaging Het
Luzp1 T C 4: 136,540,682 V72A probably damaging Het
Malrd1 G A 2: 15,526,653 V8M probably benign Het
Msmo1 T C 8: 64,719,110 H253R probably damaging Het
Nom1 A G 5: 29,435,126 K150R possibly damaging Het
Olfr310 T A 7: 86,269,520 M90L probably benign Het
Olfr360 A G 2: 37,068,989 H228R probably benign Het
Olfr483 T C 7: 108,103,798 V163A possibly damaging Het
Onecut1 A G 9: 74,862,760 E155G probably benign Het
Osbpl10 G A 9: 115,061,876 V111M probably damaging Het
Pcdhgb6 T C 18: 37,744,404 S722P probably benign Het
Plin4 T A 17: 56,107,064 D187V probably damaging Het
Pmf1 T C 3: 88,395,987 E89G possibly damaging Het
Polr1d A T 5: 147,077,598 probably benign Het
Ppp1r9a T C 6: 5,158,200 Y1006H probably damaging Het
Ppp2r5c A G 12: 110,570,700 K420E probably benign Het
Prdx1 T C 4: 116,693,809 L159P probably damaging Het
Psmd6 G T 14: 14,119,990 D39E probably benign Het
Rffl T C 11: 82,818,418 K60E probably damaging Het
Rspo2 A T 15: 43,075,887 L169Q probably damaging Het
Sbf1 T A 15: 89,288,634 D1892V probably damaging Het
Sbno2 G A 10: 80,066,590 S475F possibly damaging Het
Serpina3i T A 12: 104,265,215 V37E probably benign Het
Siglecf G A 7: 43,351,713 C35Y probably damaging Het
Slc22a27 G T 19: 7,926,402 D123E probably damaging Het
Smim23 T A 11: 32,820,592 K105* probably null Het
Soat1 C T 1: 156,437,748 S348N probably benign Het
Sp2 C T 11: 96,960,985 probably benign Het
St3gal1 T A 15: 67,113,785 K7* probably null Het
Tgm1 T C 14: 55,705,554 K610E probably benign Het
Tob1 T A 11: 94,213,757 Y40N probably damaging Het
Tob1 T A 11: 94,213,759 Y40* probably null Het
Trpc4ap A G 2: 155,635,210 probably benign Het
Ttc9 C T 12: 81,631,676 P91L probably benign Het
Zbtb18 T C 1: 177,447,880 S269P probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfyve16 A T 13: 92,513,902 V858E probably damaging Het
Other mutations in St14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:St14 APN 9 31103779 missense probably damaging 1.00
IGL01443:St14 APN 9 31100193 nonsense probably null
IGL01816:St14 APN 9 31108267 missense possibly damaging 0.71
IGL02100:St14 APN 9 31100130 splice site probably benign
IGL02494:St14 APN 9 31108645 missense possibly damaging 0.47
IGL02588:St14 APN 9 31090033 splice site probably benign
IGL02663:St14 APN 9 31100382 splice site probably null
IGL02711:St14 APN 9 31089900 missense probably benign 0.05
IGL03130:St14 APN 9 31097071 critical splice donor site probably null
IGL03296:St14 APN 9 31108712 missense probably damaging 0.98
IGL03400:St14 APN 9 31096971 splice site probably benign
R0101:St14 UTSW 9 31097107 missense probably benign 0.23
R0225:St14 UTSW 9 31108284 critical splice acceptor site probably null
R0335:St14 UTSW 9 31091324 splice site probably benign
R0892:St14 UTSW 9 31100428 missense probably benign 0.38
R1334:St14 UTSW 9 31108210 missense probably damaging 1.00
R1487:St14 UTSW 9 31097180 missense probably damaging 1.00
R1521:St14 UTSW 9 31108215 missense probably benign 0.03
R1782:St14 UTSW 9 31100164 missense probably damaging 1.00
R1920:St14 UTSW 9 31089870 missense possibly damaging 0.94
R1921:St14 UTSW 9 31089870 missense possibly damaging 0.94
R1922:St14 UTSW 9 31089870 missense possibly damaging 0.94
R1933:St14 UTSW 9 31106212 missense probably benign 0.00
R2070:St14 UTSW 9 31091373 missense probably damaging 1.00
R2411:St14 UTSW 9 31108234 missense probably benign 0.13
R4152:St14 UTSW 9 31090506 missense probably benign 0.08
R4375:St14 UTSW 9 31090458 missense probably benign 0.02
R4419:St14 UTSW 9 31096928 missense probably damaging 1.00
R4747:St14 UTSW 9 31103757 missense possibly damaging 0.78
R4791:St14 UTSW 9 31095622 missense probably benign 0.27
R4915:St14 UTSW 9 31108664 nonsense probably null
R5056:St14 UTSW 9 31097551 splice site probably null
R5134:St14 UTSW 9 31095583 missense probably benign 0.00
R5241:St14 UTSW 9 31100418 nonsense probably null
R5325:St14 UTSW 9 31096978 splice site probably null
R5644:St14 UTSW 9 31106510 missense probably benign
R5922:St14 UTSW 9 31129904 intron probably benign
R5930:St14 UTSW 9 31103760 missense probably damaging 1.00
R5963:St14 UTSW 9 31106557 intron probably benign
R6911:St14 UTSW 9 31106785 missense probably benign 0.00
R6937:St14 UTSW 9 31129660 intron probably null
R6986:St14 UTSW 9 31096549 missense probably damaging 0.98
R7226:St14 UTSW 9 31100152 missense possibly damaging 0.63
R7395:St14 UTSW 9 31096899 missense probably benign 0.29
R7400:St14 UTSW 9 31108275 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TGCAAGAACCCATAGCCTG -3'
(R):5'- TGCGTTCATAGCCATCCACC -3'

Sequencing Primer
(F):5'- TGGTCTGGCATGAAGCTCAC -3'
(R):5'- GTTCATAGCCATCCACCCCACC -3'
Posted On2016-12-20