Incidental Mutation 'R5722:Rbm46'
List |< first << previous [record 33 of 51] next >> last >|
ID452254
Institutional Source Beutler Lab
Gene Symbol Rbm46
Ensembl Gene ENSMUSG00000033882
Gene NameRNA binding motif protein 46
SynonymsENSMUSG00000033882, LOC329687
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location82837228-82876483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82865333 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 164 (V164A)
Ref Sequence ENSEMBL: ENSMUSP00000045511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048647] [ENSMUST00000182637] [ENSMUST00000182818]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048647
AA Change: V164A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045511
Gene: ENSMUSG00000033882
AA Change: V164A

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
RRM 62 135 8.13e-15 SMART
RRM 142 219 1.36e-7 SMART
RRM 237 304 4.23e-13 SMART
Pfam:DND1_DSRM 392 468 9.4e-30 PFAM
low complexity region 494 514 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182637
AA Change: V164A

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138728
Gene: ENSMUSG00000033882
AA Change: V164A

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
RRM 62 135 8.13e-15 SMART
RRM 142 219 1.36e-7 SMART
RRM 237 304 4.23e-13 SMART
Pfam:DND1_DSRM 392 468 1.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182818
AA Change: V164A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138429
Gene: ENSMUSG00000033882
AA Change: V164A

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
RRM 62 135 8.13e-15 SMART
RRM 142 219 1.36e-7 SMART
RRM 237 304 4.23e-13 SMART
Pfam:DND1_DSRM 392 468 2.1e-29 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Rbm46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Rbm46 APN 3 82864416 missense possibly damaging 0.85
R0048:Rbm46 UTSW 3 82864230 missense probably damaging 0.96
R0554:Rbm46 UTSW 3 82865268 missense probably damaging 1.00
R1606:Rbm46 UTSW 3 82864541 missense probably damaging 1.00
R2200:Rbm46 UTSW 3 82864044 missense probably benign 0.00
R2357:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R4646:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R4647:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R4648:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R5584:Rbm46 UTSW 3 82864158 missense probably benign
R6393:Rbm46 UTSW 3 82863955 missense probably benign 0.03
R7228:Rbm46 UTSW 3 82842533 missense probably benign
R7438:Rbm46 UTSW 3 82842488 nonsense probably null
R7445:Rbm46 UTSW 3 82864210 missense probably damaging 0.99
R7452:Rbm46 UTSW 3 82864121 missense probably benign 0.01
Z1177:Rbm46 UTSW 3 82837318 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCTTCATGTGGCATTATATAGC -3'
(R):5'- CCTGTATTTGAAAGAGCTGGGAAG -3'

Sequencing Primer
(F):5'- AATCAGCTTTCTCCTGGC -3'
(R):5'- TTAGTGGTGAAAATAGAGGTTATGC -3'
Posted On2017-01-03