Incidental Mutation 'R5863:Add3'
ID 454035
Institutional Source Beutler Lab
Gene Symbol Add3
Ensembl Gene ENSMUSG00000025026
Gene Name adducin 3
Synonyms
MMRRC Submission 043232-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5863 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 53128874-53235518 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 53222301 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 303 (L303I)
Ref Sequence ENSEMBL: ENSMUSP00000107370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025999] [ENSMUST00000050096] [ENSMUST00000111741]
AlphaFold Q9QYB5
Predicted Effect probably benign
Transcript: ENSMUST00000025999
AA Change: L303I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000025999
Gene: ENSMUSG00000025026
AA Change: L303I

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050096
AA Change: L303I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000052245
Gene: ENSMUSG00000025026
AA Change: L303I

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
low complexity region 618 630 N/A INTRINSIC
low complexity region 641 671 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111741
AA Change: L303I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107370
Gene: ENSMUSG00000025026
AA Change: L303I

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced adducin gamma transcripts encoding different isoforms have been described. The functions of the different isoforms are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal blood pressure and show no significant alterations in red blood cell or platelet structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T C 5: 125,580,287 (GRCm39) I204T possibly damaging Het
Abcc2 A G 19: 43,786,575 (GRCm39) I136V probably benign Het
Adam6a T C 12: 113,507,987 (GRCm39) I120T probably benign Het
Anln A G 9: 22,249,280 (GRCm39) L149P probably damaging Het
Arhgef4 A G 1: 34,761,926 (GRCm39) E394G unknown Het
Asns G A 6: 7,675,443 (GRCm39) Q520* probably null Het
Auh T G 13: 53,052,694 (GRCm39) N141T probably benign Het
B3galt2 G A 1: 143,522,104 (GRCm39) R80Q probably benign Het
Bcl9 T C 3: 97,117,666 (GRCm39) T343A probably benign Het
C3 T A 17: 57,530,141 (GRCm39) I487F probably benign Het
Cast T C 13: 74,884,875 (GRCm39) K326E probably damaging Het
Ccdc185 T A 1: 182,576,122 (GRCm39) H189L possibly damaging Het
Cep112 A G 11: 108,497,058 (GRCm39) E51G probably damaging Het
Cpvl G A 6: 53,850,413 (GRCm39) P475S probably damaging Het
Cstf2t G T 19: 31,060,477 (GRCm39) L4F probably damaging Het
Dido1 A G 2: 180,303,566 (GRCm39) V1446A probably benign Het
Dlg2 T A 7: 91,360,987 (GRCm39) M35K probably benign Het
Dnah12 C T 14: 26,576,878 (GRCm39) L3043F probably damaging Het
Fam135a A G 1: 24,053,863 (GRCm39) S1225P possibly damaging Het
Fhod3 T C 18: 25,258,810 (GRCm39) F1443S probably benign Het
Flacc1 G T 1: 58,730,908 (GRCm39) H49Q probably benign Het
Gm14226 C A 2: 154,866,211 (GRCm39) T56N probably benign Het
Itgb4 C T 11: 115,881,748 (GRCm39) R766W probably damaging Het
Kcnj8 T A 6: 142,511,414 (GRCm39) I398F probably benign Het
Khdrbs1 G A 4: 129,616,493 (GRCm39) R284C probably damaging Het
Nog A G 11: 89,192,356 (GRCm39) L164P probably damaging Het
Or13a18 G A 7: 140,190,544 (GRCm39) G155D probably damaging Het
Or8c20 T C 9: 38,261,083 (GRCm39) S235P probably benign Het
Pkhd1 T A 1: 20,590,434 (GRCm39) Q1771L possibly damaging Het
Prl3c1 T A 13: 27,387,593 (GRCm39) *193K probably null Het
Prpf4b T A 13: 35,083,111 (GRCm39) I829N possibly damaging Het
Rassf1 C T 9: 107,435,023 (GRCm39) P103S probably damaging Het
Rdh16f2 A C 10: 127,712,256 (GRCm39) I238L probably benign Het
Sdk2 G T 11: 113,725,810 (GRCm39) D1146E probably damaging Het
Slc16a3 T C 11: 120,848,779 (GRCm39) F412L probably benign Het
Slc24a1 T C 9: 64,835,824 (GRCm39) T768A unknown Het
Stk32a A G 18: 43,448,209 (GRCm39) N396S probably benign Het
Ston1 T C 17: 88,943,373 (GRCm39) S260P possibly damaging Het
Tmem135 A G 7: 88,797,176 (GRCm39) probably null Het
Tmem30c A G 16: 57,090,418 (GRCm39) V263A probably benign Het
Ttn T A 2: 76,587,102 (GRCm39) T21632S probably damaging Het
Ube2w A G 1: 16,655,531 (GRCm39) I141T probably damaging Het
Zbtb47 A G 9: 121,596,596 (GRCm39) S651G probably benign Het
Zscan20 A T 4: 128,480,141 (GRCm39) C783* probably null Het
Other mutations in Add3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Add3 APN 19 53,227,861 (GRCm39) missense probably damaging 1.00
IGL02177:Add3 APN 19 53,205,323 (GRCm39) nonsense probably null
IGL03093:Add3 APN 19 53,219,638 (GRCm39) missense probably damaging 1.00
IGL03047:Add3 UTSW 19 53,231,022 (GRCm39) missense probably benign 0.00
PIT4243001:Add3 UTSW 19 53,225,121 (GRCm39) missense probably benign 0.00
PIT4366001:Add3 UTSW 19 53,205,298 (GRCm39) missense unknown
R0087:Add3 UTSW 19 53,215,038 (GRCm39) missense probably damaging 1.00
R0335:Add3 UTSW 19 53,225,259 (GRCm39) missense probably benign 0.00
R0346:Add3 UTSW 19 53,205,387 (GRCm39) nonsense probably null
R0514:Add3 UTSW 19 53,225,274 (GRCm39) nonsense probably null
R0692:Add3 UTSW 19 53,205,383 (GRCm39) missense probably damaging 1.00
R1437:Add3 UTSW 19 53,222,109 (GRCm39) missense probably damaging 0.98
R1747:Add3 UTSW 19 53,230,981 (GRCm39) missense probably benign 0.41
R2926:Add3 UTSW 19 53,215,253 (GRCm39) splice site probably null
R4192:Add3 UTSW 19 53,230,955 (GRCm39) missense probably benign 0.00
R4780:Add3 UTSW 19 53,223,223 (GRCm39) missense possibly damaging 0.64
R5019:Add3 UTSW 19 53,231,002 (GRCm39) missense probably damaging 0.99
R5486:Add3 UTSW 19 53,232,818 (GRCm39) missense probably benign 0.00
R5526:Add3 UTSW 19 53,215,038 (GRCm39) missense probably damaging 1.00
R5580:Add3 UTSW 19 53,233,642 (GRCm39) missense probably damaging 1.00
R5851:Add3 UTSW 19 53,225,205 (GRCm39) missense probably damaging 1.00
R5951:Add3 UTSW 19 53,232,720 (GRCm39) splice site probably null
R6229:Add3 UTSW 19 53,223,277 (GRCm39) missense probably benign 0.35
R7017:Add3 UTSW 19 53,222,284 (GRCm39) missense possibly damaging 0.94
R7190:Add3 UTSW 19 53,205,330 (GRCm39) nonsense probably null
R7222:Add3 UTSW 19 53,205,277 (GRCm39) missense unknown
R7231:Add3 UTSW 19 53,221,577 (GRCm39) missense probably benign 0.00
R7532:Add3 UTSW 19 53,220,589 (GRCm39) missense probably damaging 1.00
R7557:Add3 UTSW 19 53,227,868 (GRCm39) missense probably damaging 0.98
R7726:Add3 UTSW 19 53,227,892 (GRCm39) missense probably damaging 1.00
R9063:Add3 UTSW 19 53,222,302 (GRCm39) missense probably damaging 0.98
R9069:Add3 UTSW 19 53,222,332 (GRCm39) missense possibly damaging 0.92
R9371:Add3 UTSW 19 53,221,499 (GRCm39) missense probably damaging 1.00
R9550:Add3 UTSW 19 53,233,521 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGGTCCAAGCTGTAAGGTAC -3'
(R):5'- TCAGCTCTTAGACTGTGGGC -3'

Sequencing Primer
(F):5'- AAGGTACGCACTGCTCTGTATCAG -3'
(R):5'- TCAGGGATAACTGAGCTCACAAGC -3'
Posted On 2017-02-10