Incidental Mutation 'R5877:Rps2'
ID455623
Institutional Source Beutler Lab
Gene Symbol Rps2
Ensembl Gene ENSMUSG00000044533
Gene Nameribosomal protein S2
SynonymsLlrep3, Rps2
MMRRC Submission 044083-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R5877 (G1)
Quality Score149
Status Validated
Chromosome17
Chromosomal Location24718116-24721929 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 24720916 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008626] [ENSMUST00000045602] [ENSMUST00000054289] [ENSMUST00000135708] [ENSMUST00000146867] [ENSMUST00000152407] [ENSMUST00000170715]
Predicted Effect probably benign
Transcript: ENSMUST00000008626
SMART Domains Protein: ENSMUSP00000008626
Gene: ENSMUSG00000008482

DomainStartEndE-ValueType
RING 20 57 1.76e-5 SMART
Pfam:zf-TRAF 102 158 7.5e-9 PFAM
low complexity region 176 193 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045602
SMART Domains Protein: ENSMUSP00000043543
Gene: ENSMUSG00000040048

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 42 168 2.1e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054289
SMART Domains Protein: ENSMUSP00000092502
Gene: ENSMUSG00000044533

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 102 166 5.7e-34 PFAM
Pfam:Ribosomal_S5_C 185 256 2.4e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132803
Predicted Effect probably benign
Transcript: ENSMUST00000135708
SMART Domains Protein: ENSMUSP00000120091
Gene: ENSMUSG00000040048

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 54 149 7.1e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144285
Predicted Effect probably benign
Transcript: ENSMUST00000146867
SMART Domains Protein: ENSMUSP00000120715
Gene: ENSMUSG00000044533

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 102 166 1.7e-35 PFAM
Pfam:Ribosomal_S5_C 185 256 8.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147648
Predicted Effect probably benign
Transcript: ENSMUST00000152407
SMART Domains Protein: ENSMUSP00000114529
Gene: ENSMUSG00000044533

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 101 167 9.2e-32 PFAM
Pfam:Ribosomal_S5_C 184 257 1.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161706
Predicted Effect probably benign
Transcript: ENSMUST00000170715
SMART Domains Protein: ENSMUSP00000131474
Gene: ENSMUSG00000044533

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 101 167 1.1e-31 PFAM
Pfam:Ribosomal_S5_C 184 257 1.3e-24 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S5P family of ribosomal proteins. It is located in the cytoplasm. This gene shares sequence similarity with mouse LLRep3. It is co-transcribed with the small nucleolar RNA gene U64, which is located in its third intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik G T 18: 77,643,206 probably null Het
Adam6b A T 12: 113,490,202 H213L probably damaging Het
Alk A G 17: 71,967,526 W597R probably damaging Het
Ash1l G A 3: 88,981,584 V257I probably benign Het
Atp9b C T 18: 80,752,789 V957I probably benign Het
Birc3 A C 9: 7,849,346 C576G probably damaging Het
Brca2 T C 5: 150,543,221 M2150T possibly damaging Het
C3ar1 T G 6: 122,850,622 D212A probably benign Het
Cacna1s T C 1: 136,100,667 F914S probably damaging Het
Camk1d T C 2: 5,565,665 I62V probably benign Het
Caskin1 T C 17: 24,505,265 M1009T possibly damaging Het
Casp2 A G 6: 42,276,637 probably benign Het
Cd2bp2 T A 7: 127,194,799 Y106F probably damaging Het
Celsr3 G A 9: 108,845,727 C2763Y probably damaging Het
Cyp2g1 T G 7: 26,816,640 L310V possibly damaging Het
Dusp22 G A 13: 30,707,961 V99M probably damaging Het
Fam131b G A 6: 42,320,979 S92L probably benign Het
Fbxw10 A T 11: 62,857,716 N390Y probably damaging Het
Flg2 A T 3: 93,203,449 H928L unknown Het
Gapdhs T C 7: 30,732,347 T280A probably damaging Het
Hdac11 A G 6: 91,157,542 K50E probably damaging Het
Hif3a G T 7: 17,051,146 A181E probably damaging Het
Ikbkap A T 4: 56,787,807 W375R probably damaging Het
Itgb8 A G 12: 119,202,536 S87P probably benign Het
Klhl12 T A 1: 134,483,820 Y302* probably null Het
Lhx1 C A 11: 84,522,239 D30Y probably damaging Het
Mrpl40 A G 16: 18,872,385 Y148H probably damaging Het
Myh13 A T 11: 67,353,658 H1007L possibly damaging Het
Nhlrc2 T C 19: 56,570,584 I167T probably damaging Het
Nxpe3 A T 16: 55,866,201 I148K probably damaging Het
Odf2l A G 3: 145,129,010 probably null Het
Otud7b C T 3: 96,151,960 R347* probably null Het
P3h4 G T 11: 100,414,017 H181Q probably benign Het
P4htm T A 9: 108,583,733 Y180F possibly damaging Het
Pcna-ps2 A G 19: 9,284,099 I241V probably benign Het
Pcnx2 T C 8: 125,753,728 S1947G probably damaging Het
Piezo2 T C 18: 63,113,934 I336V probably benign Het
Plcd1 T C 9: 119,076,172 D157G probably damaging Het
Plekhm2 A C 4: 141,639,693 I212S probably damaging Het
Pmvk G T 3: 89,464,369 C57F probably benign Het
Pole T C 5: 110,332,463 S91P probably benign Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Ppp4r3b A T 11: 29,209,356 D570V probably damaging Het
Pxdn T A 12: 30,003,046 I1074N probably damaging Het
Ralgapa2 A T 2: 146,388,569 D1025E probably damaging Het
Ralgps1 A G 2: 33,243,628 probably benign Het
Rasal1 C T 5: 120,679,070 probably benign Het
Scn7a G C 2: 66,699,873 Y709* probably null Het
Skint1 T A 4: 112,021,523 C217* probably null Het
Slc50a1 T C 3: 89,269,153 Y82C probably damaging Het
Slc9a4 T C 1: 40,612,263 V567A probably benign Het
Snx27 A T 3: 94,502,963 W469R probably damaging Het
Sos2 A G 12: 69,596,795 L937P probably damaging Het
Ssh1 T C 5: 113,943,120 T728A probably benign Het
Tnfrsf8 G A 4: 145,292,687 R193C probably benign Het
Usp33 T A 3: 152,379,476 M583K possibly damaging Het
Usp33 G A 3: 152,379,596 C623Y probably damaging Het
Wdfy3 T C 5: 101,869,989 I2562V probably damaging Het
Wnk2 T C 13: 49,067,306 D1175G probably damaging Het
Zcchc11 T C 4: 108,512,923 V673A probably damaging Het
Zfp341 G A 2: 154,632,289 E338K probably damaging Het
Zfp398 A G 6: 47,840,704 probably benign Het
Zp2 T A 7: 120,133,339 K661N probably null Het
Other mutations in Rps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Rps2 APN 17 24720676 missense probably damaging 1.00
IGL02981:Rps2 APN 17 24721724 missense probably benign 0.00
IGL03123:Rps2 APN 17 24720289 unclassified probably benign
R2504:Rps2 UTSW 17 24720379 unclassified probably benign
R3160:Rps2 UTSW 17 24720978 missense probably benign 0.16
R3161:Rps2 UTSW 17 24720978 missense probably benign 0.16
R3162:Rps2 UTSW 17 24720978 missense probably benign 0.16
R7247:Rps2 UTSW 17 24720580 missense possibly damaging 0.86
R8135:Rps2 UTSW 17 24720435 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGACCAGGTTCAAGGTTGGTTAAG -3'
(R):5'- GGGCTTGCCAATCTTGTTCC -3'

Sequencing Primer
(F):5'- CCAGGTTCAAGGTTGGTTAAGATTGC -3'
(R):5'- AGTAGCCTCTCCGCACAG -3'
Posted On2017-02-10