Incidental Mutation 'R5877:Ppp4r3b'
ID455610
Institutional Source Beutler Lab
Gene Symbol Ppp4r3b
Ensembl Gene ENSMUSG00000020463
Gene Nameprotein phosphatase 4 regulatory subunit 3B
SynonymsSmek2
MMRRC Submission 044083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5877 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29172890-29220797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29209356 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 570 (D570V)
Ref Sequence ENSEMBL: ENSMUSP00000099920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020755] [ENSMUST00000102856] [ENSMUST00000127621]
Predicted Effect probably damaging
Transcript: ENSMUST00000020755
AA Change: D570V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020755
Gene: ENSMUSG00000020463
AA Change: D570V

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 2e-24 SMART
low complexity region 116 127 N/A INTRINSIC
Pfam:SMK-1 168 359 3.6e-84 PFAM
low complexity region 511 519 N/A INTRINSIC
low complexity region 800 809 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102856
AA Change: D570V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099920
Gene: ENSMUSG00000020463
AA Change: D570V

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 2e-25 SMART
low complexity region 116 127 N/A INTRINSIC
Pfam:SMK-1 166 359 3.8e-87 PFAM
low complexity region 511 519 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127621
AA Change: D149V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117918
Gene: ENSMUSG00000020463
AA Change: D149V

DomainStartEndE-ValueType
low complexity region 90 98 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127818
Predicted Effect probably benign
Transcript: ENSMUST00000148759
Meta Mutation Damage Score 0.8451 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik G T 18: 77,643,206 probably null Het
Adam6b A T 12: 113,490,202 H213L probably damaging Het
Alk A G 17: 71,967,526 W597R probably damaging Het
Ash1l G A 3: 88,981,584 V257I probably benign Het
Atp9b C T 18: 80,752,789 V957I probably benign Het
Birc3 A C 9: 7,849,346 C576G probably damaging Het
Brca2 T C 5: 150,543,221 M2150T possibly damaging Het
C3ar1 T G 6: 122,850,622 D212A probably benign Het
Cacna1s T C 1: 136,100,667 F914S probably damaging Het
Camk1d T C 2: 5,565,665 I62V probably benign Het
Caskin1 T C 17: 24,505,265 M1009T possibly damaging Het
Casp2 A G 6: 42,276,637 probably benign Het
Cd2bp2 T A 7: 127,194,799 Y106F probably damaging Het
Celsr3 G A 9: 108,845,727 C2763Y probably damaging Het
Cyp2g1 T G 7: 26,816,640 L310V possibly damaging Het
Dusp22 G A 13: 30,707,961 V99M probably damaging Het
Fam131b G A 6: 42,320,979 S92L probably benign Het
Fbxw10 A T 11: 62,857,716 N390Y probably damaging Het
Flg2 A T 3: 93,203,449 H928L unknown Het
Gapdhs T C 7: 30,732,347 T280A probably damaging Het
Hdac11 A G 6: 91,157,542 K50E probably damaging Het
Hif3a G T 7: 17,051,146 A181E probably damaging Het
Ikbkap A T 4: 56,787,807 W375R probably damaging Het
Itgb8 A G 12: 119,202,536 S87P probably benign Het
Klhl12 T A 1: 134,483,820 Y302* probably null Het
Lhx1 C A 11: 84,522,239 D30Y probably damaging Het
Mrpl40 A G 16: 18,872,385 Y148H probably damaging Het
Myh13 A T 11: 67,353,658 H1007L possibly damaging Het
Nhlrc2 T C 19: 56,570,584 I167T probably damaging Het
Nxpe3 A T 16: 55,866,201 I148K probably damaging Het
Odf2l A G 3: 145,129,010 probably null Het
Otud7b C T 3: 96,151,960 R347* probably null Het
P3h4 G T 11: 100,414,017 H181Q probably benign Het
P4htm T A 9: 108,583,733 Y180F possibly damaging Het
Pcna-ps2 A G 19: 9,284,099 I241V probably benign Het
Pcnx2 T C 8: 125,753,728 S1947G probably damaging Het
Piezo2 T C 18: 63,113,934 I336V probably benign Het
Plcd1 T C 9: 119,076,172 D157G probably damaging Het
Plekhm2 A C 4: 141,639,693 I212S probably damaging Het
Pmvk G T 3: 89,464,369 C57F probably benign Het
Pole T C 5: 110,332,463 S91P probably benign Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Pxdn T A 12: 30,003,046 I1074N probably damaging Het
Ralgapa2 A T 2: 146,388,569 D1025E probably damaging Het
Ralgps1 A G 2: 33,243,628 probably benign Het
Rasal1 C T 5: 120,679,070 probably benign Het
Rps2 A T 17: 24,720,916 probably benign Het
Scn7a G C 2: 66,699,873 Y709* probably null Het
Skint1 T A 4: 112,021,523 C217* probably null Het
Slc50a1 T C 3: 89,269,153 Y82C probably damaging Het
Slc9a4 T C 1: 40,612,263 V567A probably benign Het
Snx27 A T 3: 94,502,963 W469R probably damaging Het
Sos2 A G 12: 69,596,795 L937P probably damaging Het
Ssh1 T C 5: 113,943,120 T728A probably benign Het
Tnfrsf8 G A 4: 145,292,687 R193C probably benign Het
Usp33 T A 3: 152,379,476 M583K possibly damaging Het
Usp33 G A 3: 152,379,596 C623Y probably damaging Het
Wdfy3 T C 5: 101,869,989 I2562V probably damaging Het
Wnk2 T C 13: 49,067,306 D1175G probably damaging Het
Zcchc11 T C 4: 108,512,923 V673A probably damaging Het
Zfp341 G A 2: 154,632,289 E338K probably damaging Het
Zfp398 A G 6: 47,840,704 probably benign Het
Zp2 T A 7: 120,133,339 K661N probably null Het
Other mutations in Ppp4r3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Ppp4r3b APN 11 29211782 missense possibly damaging 0.64
IGL00593:Ppp4r3b APN 11 29197205 missense possibly damaging 0.88
IGL01109:Ppp4r3b APN 11 29188288 missense probably damaging 0.97
IGL01311:Ppp4r3b APN 11 29194591 missense probably benign
IGL01397:Ppp4r3b APN 11 29213594 missense probably benign 0.05
IGL01546:Ppp4r3b APN 11 29209488 unclassified probably null
IGL02588:Ppp4r3b APN 11 29198853 nonsense probably null
IGL02713:Ppp4r3b APN 11 29188445 missense probably damaging 0.98
IGL02717:Ppp4r3b APN 11 29173315 missense probably benign 0.01
PIT1430001:Ppp4r3b UTSW 11 29209434 missense probably benign 0.04
PIT4677001:Ppp4r3b UTSW 11 29187978 missense probably benign
R0766:Ppp4r3b UTSW 11 29173358 missense probably benign 0.16
R1170:Ppp4r3b UTSW 11 29209426 missense probably damaging 0.99
R1312:Ppp4r3b UTSW 11 29173358 missense probably benign 0.16
R1511:Ppp4r3b UTSW 11 29182460 missense probably damaging 1.00
R1692:Ppp4r3b UTSW 11 29188123 missense probably benign 0.02
R1699:Ppp4r3b UTSW 11 29213765 missense possibly damaging 0.52
R2303:Ppp4r3b UTSW 11 29200741 missense possibly damaging 0.79
R2339:Ppp4r3b UTSW 11 29200725 missense possibly damaging 0.65
R4378:Ppp4r3b UTSW 11 29209450 missense possibly damaging 0.72
R4940:Ppp4r3b UTSW 11 29211740 missense probably benign
R5256:Ppp4r3b UTSW 11 29188293 missense probably benign 0.22
R5266:Ppp4r3b UTSW 11 29173309 missense possibly damaging 0.63
R5286:Ppp4r3b UTSW 11 29211667 missense probably benign
R5354:Ppp4r3b UTSW 11 29211646 missense probably benign 0.26
R6364:Ppp4r3b UTSW 11 29188035 missense probably benign 0.00
R6539:Ppp4r3b UTSW 11 29218503 missense probably benign 0.00
R6773:Ppp4r3b UTSW 11 29205639 missense probably benign 0.02
R6931:Ppp4r3b UTSW 11 29211786 missense possibly damaging 0.88
R7051:Ppp4r3b UTSW 11 29182507 missense probably damaging 1.00
R7176:Ppp4r3b UTSW 11 29198904 missense probably damaging 1.00
R7569:Ppp4r3b UTSW 11 29188540 missense possibly damaging 0.91
R7741:Ppp4r3b UTSW 11 29205701 missense possibly damaging 0.78
R7746:Ppp4r3b UTSW 11 29173352 missense probably benign 0.00
R7810:Ppp4r3b UTSW 11 29188086 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGCTCCAAGTATTACTAGCAGGAG -3'
(R):5'- GCATTCAACCATCAACCGTG -3'

Sequencing Primer
(F):5'- GAGCCAAGCCAGTTGTCATTC -3'
(R):5'- TCAACCATCAACCGTGTATAAGTAAG -3'
Posted On2017-02-10