Incidental Mutation 'R5877:Usp33'
ID455583
Institutional Source Beutler Lab
Gene Symbol Usp33
Ensembl Gene ENSMUSG00000025437
Gene Nameubiquitin specific peptidase 33
SynonymsVdu1, 9830169D19Rik
MMRRC Submission 044083-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.793) question?
Stock #R5877 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location152346478-152393617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152379476 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 583 (M583K)
Ref Sequence ENSEMBL: ENSMUSP00000026507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026507] [ENSMUST00000117492] [ENSMUST00000197748]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026507
AA Change: M583K

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026507
Gene: ENSMUSG00000025437
AA Change: M583K

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 1.7e-18 PFAM
low complexity region 136 148 N/A INTRINSIC
Pfam:UCH 153 671 2.2e-71 PFAM
Pfam:UCH_1 154 387 1.4e-9 PFAM
Pfam:UCH_1 371 653 6.8e-25 PFAM
DUSP 691 774 4.4e-17 SMART
DUSP 799 883 2.44e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117492
AA Change: M583K

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113265
Gene: ENSMUSG00000025437
AA Change: M583K

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 1e-18 PFAM
low complexity region 136 148 N/A INTRINSIC
Pfam:UCH 153 679 1.6e-64 PFAM
Pfam:UCH_1 154 387 1.2e-8 PFAM
Pfam:UCH_1 366 661 1.3e-23 PFAM
DUSP 699 782 4.4e-17 SMART
DUSP 807 891 2.44e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197325
Predicted Effect probably benign
Transcript: ENSMUST00000197600
Predicted Effect probably benign
Transcript: ENSMUST00000197748
AA Change: M591K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000142708
Gene: ENSMUSG00000025437
AA Change: M591K

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 1.7e-18 PFAM
low complexity region 136 148 N/A INTRINSIC
Pfam:UCH 153 679 2.3e-71 PFAM
Pfam:UCH_1 154 383 1.2e-9 PFAM
Pfam:UCH_1 368 661 1e-24 PFAM
DUSP 699 782 4.4e-17 SMART
DUSP 807 891 2.44e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200075
Meta Mutation Damage Score 0.6382 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquinating enzyme important in a variety of processes, including Slit-dependent cell migration and beta-2 adrenergic receptor signaling. The protein is negatively regulated through ubiquitination by von Hippel-Lindau tumor protein (VHL). Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik G T 18: 77,643,206 probably null Het
Adam6b A T 12: 113,490,202 H213L probably damaging Het
Alk A G 17: 71,967,526 W597R probably damaging Het
Ash1l G A 3: 88,981,584 V257I probably benign Het
Atp9b C T 18: 80,752,789 V957I probably benign Het
Birc3 A C 9: 7,849,346 C576G probably damaging Het
Brca2 T C 5: 150,543,221 M2150T possibly damaging Het
C3ar1 T G 6: 122,850,622 D212A probably benign Het
Cacna1s T C 1: 136,100,667 F914S probably damaging Het
Camk1d T C 2: 5,565,665 I62V probably benign Het
Caskin1 T C 17: 24,505,265 M1009T possibly damaging Het
Casp2 A G 6: 42,276,637 probably benign Het
Cd2bp2 T A 7: 127,194,799 Y106F probably damaging Het
Celsr3 G A 9: 108,845,727 C2763Y probably damaging Het
Cyp2g1 T G 7: 26,816,640 L310V possibly damaging Het
Dusp22 G A 13: 30,707,961 V99M probably damaging Het
Fam131b G A 6: 42,320,979 S92L probably benign Het
Fbxw10 A T 11: 62,857,716 N390Y probably damaging Het
Flg2 A T 3: 93,203,449 H928L unknown Het
Gapdhs T C 7: 30,732,347 T280A probably damaging Het
Hdac11 A G 6: 91,157,542 K50E probably damaging Het
Hif3a G T 7: 17,051,146 A181E probably damaging Het
Ikbkap A T 4: 56,787,807 W375R probably damaging Het
Itgb8 A G 12: 119,202,536 S87P probably benign Het
Klhl12 T A 1: 134,483,820 Y302* probably null Het
Lhx1 C A 11: 84,522,239 D30Y probably damaging Het
Mrpl40 A G 16: 18,872,385 Y148H probably damaging Het
Myh13 A T 11: 67,353,658 H1007L possibly damaging Het
Nhlrc2 T C 19: 56,570,584 I167T probably damaging Het
Nxpe3 A T 16: 55,866,201 I148K probably damaging Het
Odf2l A G 3: 145,129,010 probably null Het
Otud7b C T 3: 96,151,960 R347* probably null Het
P3h4 G T 11: 100,414,017 H181Q probably benign Het
P4htm T A 9: 108,583,733 Y180F possibly damaging Het
Pcna-ps2 A G 19: 9,284,099 I241V probably benign Het
Pcnx2 T C 8: 125,753,728 S1947G probably damaging Het
Piezo2 T C 18: 63,113,934 I336V probably benign Het
Plcd1 T C 9: 119,076,172 D157G probably damaging Het
Plekhm2 A C 4: 141,639,693 I212S probably damaging Het
Pmvk G T 3: 89,464,369 C57F probably benign Het
Pole T C 5: 110,332,463 S91P probably benign Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Ppp4r3b A T 11: 29,209,356 D570V probably damaging Het
Pxdn T A 12: 30,003,046 I1074N probably damaging Het
Ralgapa2 A T 2: 146,388,569 D1025E probably damaging Het
Ralgps1 A G 2: 33,243,628 probably benign Het
Rasal1 C T 5: 120,679,070 probably benign Het
Rps2 A T 17: 24,720,916 probably benign Het
Scn7a G C 2: 66,699,873 Y709* probably null Het
Skint1 T A 4: 112,021,523 C217* probably null Het
Slc50a1 T C 3: 89,269,153 Y82C probably damaging Het
Slc9a4 T C 1: 40,612,263 V567A probably benign Het
Snx27 A T 3: 94,502,963 W469R probably damaging Het
Sos2 A G 12: 69,596,795 L937P probably damaging Het
Ssh1 T C 5: 113,943,120 T728A probably benign Het
Tnfrsf8 G A 4: 145,292,687 R193C probably benign Het
Wdfy3 T C 5: 101,869,989 I2562V probably damaging Het
Wnk2 T C 13: 49,067,306 D1175G probably damaging Het
Zcchc11 T C 4: 108,512,923 V673A probably damaging Het
Zfp341 G A 2: 154,632,289 E338K probably damaging Het
Zfp398 A G 6: 47,840,704 probably benign Het
Zp2 T A 7: 120,133,339 K661N probably null Het
Other mutations in Usp33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Usp33 APN 3 152373409 missense probably benign 0.00
IGL01085:Usp33 APN 3 152368569 missense possibly damaging 0.89
IGL01335:Usp33 APN 3 152392217 missense probably damaging 0.99
IGL02095:Usp33 APN 3 152381794 missense possibly damaging 0.94
IGL02323:Usp33 APN 3 152370387 missense probably benign
IGL03010:Usp33 APN 3 152368596 missense probably benign 0.04
R0464:Usp33 UTSW 3 152376235 splice site probably benign
R0576:Usp33 UTSW 3 152384119 nonsense probably null
R0583:Usp33 UTSW 3 152368254 missense probably damaging 1.00
R0715:Usp33 UTSW 3 152380574 missense probably damaging 1.00
R1445:Usp33 UTSW 3 152368634 missense probably damaging 0.99
R1507:Usp33 UTSW 3 152374763 missense possibly damaging 0.84
R1600:Usp33 UTSW 3 152379610 missense probably damaging 0.98
R1673:Usp33 UTSW 3 152368282 missense probably damaging 1.00
R1945:Usp33 UTSW 3 152379586 missense probably benign 0.07
R1961:Usp33 UTSW 3 152380628 missense probably damaging 1.00
R1973:Usp33 UTSW 3 152360286 missense possibly damaging 0.64
R2231:Usp33 UTSW 3 152373386 missense probably benign 0.00
R2299:Usp33 UTSW 3 152374621 missense probably damaging 0.99
R3001:Usp33 UTSW 3 152357942 missense probably damaging 0.99
R3002:Usp33 UTSW 3 152357942 missense probably damaging 0.99
R3923:Usp33 UTSW 3 152374791 critical splice donor site probably null
R4366:Usp33 UTSW 3 152368512 missense probably benign 0.44
R4821:Usp33 UTSW 3 152358673 missense probably benign 0.00
R5256:Usp33 UTSW 3 152391696 nonsense probably null
R5396:Usp33 UTSW 3 152384187 missense possibly damaging 0.77
R5445:Usp33 UTSW 3 152374623 missense probably damaging 1.00
R5877:Usp33 UTSW 3 152379596 missense probably damaging 1.00
R5884:Usp33 UTSW 3 152368330 missense probably benign
R5913:Usp33 UTSW 3 152380592 missense probably damaging 1.00
R5920:Usp33 UTSW 3 152374683 missense probably damaging 1.00
R6331:Usp33 UTSW 3 152376250 missense probably damaging 1.00
R6516:Usp33 UTSW 3 152373416 missense probably benign 0.01
R6624:Usp33 UTSW 3 152381798 missense probably damaging 1.00
R6679:Usp33 UTSW 3 152368487 missense possibly damaging 0.46
R7196:Usp33 UTSW 3 152384191 missense possibly damaging 0.87
R7250:Usp33 UTSW 3 152392362 nonsense probably null
R7310:Usp33 UTSW 3 152360389 nonsense probably null
R7569:Usp33 UTSW 3 152391665 missense probably damaging 1.00
R7644:Usp33 UTSW 3 152357952 missense possibly damaging 0.47
X0025:Usp33 UTSW 3 152366758 missense probably damaging 1.00
X0058:Usp33 UTSW 3 152360346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAATCAGGTCAGAATTCAGGG -3'
(R):5'- TTCTCCCTTTGGTCAAGTGG -3'

Sequencing Primer
(F):5'- AAATTTCTGTGCATTCCAGGCCAG -3'
(R):5'- GGTCAAGTGGGGCTTATTTAAG -3'
Posted On2017-02-10