Incidental Mutation 'R5913:Pcdhb15'
ID461153
Institutional Source Beutler Lab
Gene Symbol Pcdhb15
Ensembl Gene ENSMUSG00000047033
Gene Nameprotocadherin beta 15
SynonymsPcdhbO, Pcdhb7
MMRRC Submission 044110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5913 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37473540-37476340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37474654 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 313 (Q313L)
Ref Sequence ENSEMBL: ENSMUSP00000059598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050034] [ENSMUST00000051442] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000050034
AA Change: Q313L

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000059598
Gene: ENSMUSG00000047033
AA Change: Q313L

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 345 4.37e-25 SMART
CA 368 449 4.4e-21 SMART
CA 473 559 7.38e-23 SMART
CA 589 670 4.48e-13 SMART
Pfam:Cadherin_C_2 686 770 5.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051442
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.1535 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. The transcript for this particular family member uses more than one polyadenylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl A T 9: 110,889,705 probably null Het
Arhgef19 A T 4: 141,249,298 H457L probably benign Het
Armc3 A G 2: 19,310,047 Y856C possibly damaging Het
Bdp1 A T 13: 100,051,104 V1585D probably benign Het
Bhlhe40 T G 6: 108,665,193 M366R possibly damaging Het
Bora C T 14: 99,068,512 S439L probably benign Het
Cacnb4 G A 2: 52,434,784 probably benign Het
Carm1 T C 9: 21,587,552 S529P probably benign Het
Cd200r1 A G 16: 44,789,671 I84M possibly damaging Het
Cd209a A G 8: 3,748,742 S22P probably benign Het
Celf2 A T 2: 7,081,158 M1K probably null Het
Cep112 A G 11: 108,757,688 T783A probably damaging Het
Cep95 T C 11: 106,818,509 probably benign Het
Clip4 G A 17: 71,824,765 R366K probably benign Het
Csmd2 A G 4: 128,551,988 K3284E probably benign Het
Csn3 T A 5: 87,927,611 L12Q probably damaging Het
Ctdnep1 T C 11: 69,988,865 L39P probably damaging Het
Cxcl17 C T 7: 25,402,246 W55* probably null Het
Cyp2u1 G A 3: 131,303,211 probably benign Het
Dmgdh A T 13: 93,752,323 E823V possibly damaging Het
Dnah2 T C 11: 69,448,430 I3078V probably damaging Het
Dpp10 A C 1: 123,384,289 Y446D probably damaging Het
Eif2s3y T C Y: 1,017,365 V290A probably benign Homo
Fktn G A 4: 53,735,035 W224* probably null Het
Gm37240 T C 3: 84,967,598 probably benign Het
Gm9573 C T 17: 35,623,231 probably benign Het
Gpr3 A G 4: 133,211,178 V61A probably damaging Het
Gulo T C 14: 66,000,021 probably null Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hectd4 T A 5: 121,323,974 I968K possibly damaging Het
Hmox2 G T 16: 4,764,868 R155L probably damaging Het
Ifnlr1 C A 4: 135,705,269 Q339K probably damaging Het
Ifnlr1 A T 4: 135,705,270 Q339L probably damaging Het
Irf4 T A 13: 30,757,758 S365T probably benign Het
Klrb1a T G 6: 128,618,509 D124A probably damaging Het
Macf1 A T 4: 123,476,039 I78N probably damaging Het
Mctp1 G T 13: 76,759,825 probably null Het
Mxra8 A T 4: 155,843,303 probably null Het
Nlrp2 T A 7: 5,324,903 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
P2ry13 T C 3: 59,209,365 T331A probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Pcdhga11 A G 18: 37,755,992 I18V probably benign Het
Pcdhga11 A G 18: 37,758,089 R717G probably benign Het
Pcif1 C A 2: 164,884,492 probably benign Het
Pkd1l1 T C 11: 8,863,849 T1501A probably benign Het
Plekhg2 C A 7: 28,364,602 R473L probably damaging Het
Plekhn1 T C 4: 156,222,695 Y466C probably damaging Het
Sec22c A G 9: 121,690,302 S83P possibly damaging Het
Sgcz T A 8: 37,526,271 Q224L possibly damaging Het
Slc27a1 C T 8: 71,584,263 P381L probably benign Het
Slc8a1 T A 17: 81,648,002 I536F probably damaging Het
Src T A 2: 157,466,030 probably null Het
Sybu T A 15: 44,787,621 T96S probably damaging Het
Tbc1d22a T C 15: 86,351,728 Y363H probably damaging Het
Tdrd6 T C 17: 43,628,411 E582G possibly damaging Het
Tmem131 C A 1: 36,819,128 V713L probably benign Het
Tnfsf13b T A 8: 10,006,988 L49Q probably damaging Het
Trem2 T A 17: 48,346,633 probably benign Het
Tspyl3 T A 2: 153,224,716 M201L probably benign Het
Ttl A G 2: 129,076,041 D141G probably benign Het
Ube2z A G 11: 96,061,063 V153A possibly damaging Het
Ubr3 A G 2: 70,021,215 Y1842C probably damaging Het
Usp33 T C 3: 152,380,592 V656A probably damaging Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Vmo1 A T 11: 70,514,415 V63D probably damaging Het
Zcwpw1 T A 5: 137,800,007 D155E probably benign Het
Zeb1 T G 18: 5,766,765 S425R possibly damaging Het
Other mutations in Pcdhb15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Pcdhb15 APN 18 37475154 missense probably damaging 1.00
IGL01536:Pcdhb15 APN 18 37474993 missense probably benign 0.01
IGL01664:Pcdhb15 APN 18 37474261 missense probably benign 0.35
IGL02001:Pcdhb15 APN 18 37474038 missense probably benign 0.01
IGL02161:Pcdhb15 APN 18 37475502 missense possibly damaging 0.78
IGL02205:Pcdhb15 APN 18 37473957 missense probably damaging 0.99
IGL02748:Pcdhb15 APN 18 37475220 missense probably damaging 0.98
IGL02828:Pcdhb15 APN 18 37473850 missense probably damaging 0.97
IGL02974:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
IGL03119:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
IGL03136:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
IGL03150:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
PIT1430001:Pcdhb15 UTSW 18 37475671 missense probably benign 0.15
R0266:Pcdhb15 UTSW 18 37475276 missense probably damaging 1.00
R0288:Pcdhb15 UTSW 18 37475398 missense probably damaging 1.00
R0399:Pcdhb15 UTSW 18 37474168 missense possibly damaging 0.56
R0400:Pcdhb15 UTSW 18 37475895 missense probably benign
R0554:Pcdhb15 UTSW 18 37474519 missense probably damaging 1.00
R0637:Pcdhb15 UTSW 18 37475566 missense probably damaging 1.00
R0714:Pcdhb15 UTSW 18 37474621 missense probably damaging 0.98
R1118:Pcdhb15 UTSW 18 37473762 missense probably benign 0.01
R1423:Pcdhb15 UTSW 18 37473922 missense probably damaging 0.97
R1672:Pcdhb15 UTSW 18 37474660 missense probably damaging 1.00
R1681:Pcdhb15 UTSW 18 37473813 missense probably damaging 1.00
R1779:Pcdhb15 UTSW 18 37476031 missense possibly damaging 0.95
R2206:Pcdhb15 UTSW 18 37475022 missense probably benign 0.05
R2207:Pcdhb15 UTSW 18 37475022 missense probably benign 0.05
R2274:Pcdhb15 UTSW 18 37475443 missense probably damaging 1.00
R3406:Pcdhb15 UTSW 18 37475389 missense probably benign 0.41
R3407:Pcdhb15 UTSW 18 37474389 missense possibly damaging 0.80
R3417:Pcdhb15 UTSW 18 37475163 missense probably damaging 1.00
R3752:Pcdhb15 UTSW 18 37473757 missense probably damaging 1.00
R3773:Pcdhb15 UTSW 18 37475890 missense probably benign 0.00
R4432:Pcdhb15 UTSW 18 37475512 missense probably damaging 1.00
R4433:Pcdhb15 UTSW 18 37475512 missense probably damaging 1.00
R4583:Pcdhb15 UTSW 18 37475575 missense possibly damaging 0.91
R4612:Pcdhb15 UTSW 18 37475595 missense probably damaging 0.96
R4988:Pcdhb15 UTSW 18 37475802 missense probably damaging 0.98
R5635:Pcdhb15 UTSW 18 37473770 nonsense probably null
R5692:Pcdhb15 UTSW 18 37474449 missense probably benign 0.01
R5742:Pcdhb15 UTSW 18 37474767 missense probably damaging 0.99
R6350:Pcdhb15 UTSW 18 37475361 missense probably damaging 1.00
R6522:Pcdhb15 UTSW 18 37474261 missense probably benign 0.35
R6676:Pcdhb15 UTSW 18 37474807 missense possibly damaging 0.60
R6693:Pcdhb15 UTSW 18 37474341 missense probably benign 0.01
R6905:Pcdhb15 UTSW 18 37474695 missense possibly damaging 0.95
R7029:Pcdhb15 UTSW 18 37475568 missense possibly damaging 0.85
R7335:Pcdhb15 UTSW 18 37474336 missense probably damaging 1.00
R7529:Pcdhb15 UTSW 18 37474473 nonsense probably null
R7718:Pcdhb15 UTSW 18 37475163 missense probably damaging 1.00
R7782:Pcdhb15 UTSW 18 37474735 missense possibly damaging 0.88
X0062:Pcdhb15 UTSW 18 37476015 nonsense probably null
X0063:Pcdhb15 UTSW 18 37475084 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAACACCCCTGTTGGCTCC -3'
(R):5'- CATTCGCAATGGAGCACAG -3'

Sequencing Primer
(F):5'- CCCTGTTGGCTCCTTGGTTG -3'
(R):5'- CAATGGAGCACAGGGTTTTTCC -3'
Posted On2017-02-28