Incidental Mutation 'R5936:Ddx20'
ID462240
Institutional Source Beutler Lab
Gene Symbol Ddx20
Ensembl Gene ENSMUSG00000027905
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 20
SynonymsGEMIN3, dp103
MMRRC Submission 044130-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5936 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location105678270-105687574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105680587 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 392 (E392D)
Ref Sequence ENSEMBL: ENSMUSP00000088176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090680] [ENSMUST00000200078]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090680
AA Change: E392D

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088176
Gene: ENSMUSG00000027905
AA Change: E392D

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
DEXDc 82 280 7.47e-44 SMART
HELICc 324 405 2.8e-25 SMART
low complexity region 434 445 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132008
Predicted Effect probably benign
Transcript: ENSMUST00000200078
SMART Domains Protein: ENSMUSP00000142675
Gene: ENSMUSG00000027905

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
Pfam:DEAD 87 134 7.6e-5 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 91% (77/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which has an ATPase activity and is a component of the survival of motor neurons (SMN) complex. This protein interacts directly with SMN, the spinal muscular atrophy gene product, and may play a catalytic role in the function of the SMN complex on RNPs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele fail to implant and develop past the 2-cell stage. Heterozygous null females are viable, healthy and fertile but show increased ovary weight, a greater number of empty follicles, a prolonged estrous phase, and reduced nocturnal and stress-induced serum ACTH levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,504 probably benign Het
Acnat2 T C 4: 49,383,362 T64A probably benign Het
Afap1 A G 5: 35,974,396 N356D possibly damaging Het
Ahi1 A G 10: 20,965,933 D301G probably damaging Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Ankrd46 T C 15: 36,479,282 D221G probably benign Het
Ano6 T A 15: 95,972,601 L900H probably damaging Het
Asphd2 G A 5: 112,385,757 R343* probably null Het
BC055324 T G 1: 163,987,012 I121L probably benign Het
Brdt A G 5: 107,359,395 T554A probably damaging Het
Cacna1d A G 14: 30,171,314 V401A possibly damaging Het
Cbs T C 17: 31,625,094 T188A probably damaging Het
Cfap54 T A 10: 92,962,412 T1662S probably benign Het
Chka A G 19: 3,884,580 I205V probably benign Het
Chsy1 T A 7: 66,172,277 N753K possibly damaging Het
Cpz A G 5: 35,502,643 S553P probably benign Het
Crtac1 A G 19: 42,323,837 Y146H probably damaging Het
Csf1r A T 18: 61,125,808 I700F probably damaging Het
Dhrs11 G T 11: 84,825,524 Y67* probably null Het
Diaph3 G T 14: 86,772,116 Q1076K possibly damaging Het
Dopey1 T A 9: 86,536,512 L2037* probably null Het
Dst G T 1: 34,307,458 V5336L probably damaging Het
Etv1 C A 12: 38,835,210 H248Q probably damaging Het
Fam214a T C 9: 75,009,304 L395P probably benign Het
Fcgbp T C 7: 28,086,692 V518A probably damaging Het
Fchsd2 T C 7: 101,191,701 L139S probably damaging Het
Fer A T 17: 63,924,063 T270S probably benign Het
Fgd5 A G 6: 91,987,911 E375G probably damaging Het
Gabarapl1 T A 6: 129,538,603 I68N probably benign Het
Gopc C T 10: 52,346,199 V30M probably damaging Het
Hbp1 T C 12: 31,937,096 probably null Het
Helz2 A G 2: 181,230,767 V2480A probably damaging Het
Igfbp3 T A 11: 7,209,472 Y247F probably damaging Het
Kbtbd11 C A 8: 15,027,534 S44R probably benign Het
Kcnk10 G T 12: 98,489,932 S213R probably benign Het
Kcnq3 T A 15: 66,000,110 D570V probably damaging Het
Kif21a A G 15: 90,935,647 F1594S possibly damaging Het
Klf3 A G 5: 64,822,960 D31G probably damaging Het
Mapkapk3 T C 9: 107,289,170 K59E probably damaging Het
Myo18a A G 11: 77,818,213 T484A probably damaging Het
Nlrp6 T A 7: 140,922,812 L277* probably null Het
Nr5a1 G T 2: 38,701,778 probably benign Het
Nsmaf C T 4: 6,421,017 probably benign Het
Olfr1311 T A 2: 112,021,587 H89L probably benign Het
Orc1 A G 4: 108,601,983 T450A probably benign Het
Pacsin1 A T 17: 27,704,997 I122F probably benign Het
Pced1b T A 15: 97,385,180 Y367N possibly damaging Het
Pced1b T A 15: 97,385,182 Y367* probably null Het
Pdpk1 A G 17: 24,093,229 F281L probably damaging Het
Piwil1 T C 5: 128,751,078 V714A probably benign Het
Plcd3 C T 11: 103,078,347 V265M probably damaging Het
Ppp1r1c A T 2: 79,756,454 E48V possibly damaging Het
Prl2b1 T G 13: 27,388,449 T53P probably damaging Het
Ptch2 T G 4: 117,108,294 F359V probably benign Het
R3hdm2 G A 10: 127,471,812 S314N probably damaging Het
Rictor A T 15: 6,784,161 S1043C probably damaging Het
Rtn4rl2 A T 2: 84,880,431 L163Q probably damaging Het
Sarnp T A 10: 128,848,771 S129T probably benign Het
Scube3 A T 17: 28,165,487 K585M probably damaging Het
Sgk3 C T 1: 9,885,820 probably benign Het
Skint6 C T 4: 113,096,593 S458N probably benign Het
Slc25a54 A G 3: 109,098,638 H154R possibly damaging Het
Sorbs1 A C 19: 40,324,772 I690S probably damaging Het
Sqle C A 15: 59,330,829 A512D probably damaging Het
Tedc2 A C 17: 24,216,341 L358R probably damaging Het
Tfr2 A G 5: 137,587,006 S767G probably benign Het
Thoc5 A G 11: 4,904,133 E27G probably damaging Het
Trappc8 A T 18: 20,874,688 F123L probably damaging Het
Ube2cbp C T 9: 86,372,459 G323D probably benign Het
Unc13c T A 9: 73,578,492 H1642L probably damaging Het
Vmn1r10 A T 6: 57,114,317 H298L probably benign Het
Xpo4 A T 14: 57,643,499 Y26N probably benign Het
Zer1 A G 2: 30,107,667 L409P probably damaging Het
Zfyve28 A T 5: 34,224,988 L256Q probably damaging Het
Zgrf1 A G 3: 127,562,253 E376G possibly damaging Het
Other mutations in Ddx20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ddx20 APN 3 105686670 missense probably damaging 1.00
IGL01832:Ddx20 APN 3 105679011 missense probably damaging 0.99
IGL02072:Ddx20 APN 3 105680627 missense probably damaging 1.00
IGL02821:Ddx20 APN 3 105679277 missense probably benign 0.00
R0520:Ddx20 UTSW 3 105687376 missense probably benign
R0600:Ddx20 UTSW 3 105679080 missense probably damaging 1.00
R1648:Ddx20 UTSW 3 105679188 missense probably benign 0.08
R1817:Ddx20 UTSW 3 105678580 nonsense probably null
R1843:Ddx20 UTSW 3 105679082 missense probably benign 0.00
R1922:Ddx20 UTSW 3 105678584 missense probably damaging 1.00
R1955:Ddx20 UTSW 3 105679562 missense possibly damaging 0.79
R1993:Ddx20 UTSW 3 105679344 nonsense probably null
R2215:Ddx20 UTSW 3 105680340 splice site probably benign
R2241:Ddx20 UTSW 3 105683205 nonsense probably null
R2315:Ddx20 UTSW 3 105678699 missense probably damaging 1.00
R4156:Ddx20 UTSW 3 105678933 missense probably benign 0.41
R4790:Ddx20 UTSW 3 105683169 missense probably benign 0.02
R4962:Ddx20 UTSW 3 105680605 missense possibly damaging 0.95
R5072:Ddx20 UTSW 3 105682875 critical splice donor site probably null
R5361:Ddx20 UTSW 3 105683509 missense probably damaging 0.96
R5622:Ddx20 UTSW 3 105679011 missense probably damaging 0.99
R6007:Ddx20 UTSW 3 105683420 missense possibly damaging 0.68
R6192:Ddx20 UTSW 3 105678720 missense probably benign
R6916:Ddx20 UTSW 3 105680613 missense probably damaging 1.00
R6957:Ddx20 UTSW 3 105684310 missense probably benign 0.30
R6970:Ddx20 UTSW 3 105680358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGGTCACTGTCAGTCCC -3'
(R):5'- TCTAGTTCTGGGAAAAGTGCTTTC -3'

Sequencing Primer
(F):5'- GTAGGTCACTGTCAGTCCCAATGTAC -3'
(R):5'- CATTTGCTTTGAAATAGGTTTAGTCC -3'
Posted On2017-02-28